Table 5

Sequencing primers designed each 500–1000 bp into the gamma-TMT gene
Primer Sequence (5′-3′)
F90 GGATGAATCGTTTGTTATTG
F91 GTCAATGGAGAGTGGAGAGC
F92 AGGAAGAAAAAATCTTGAATAA
F93 ATCGCTTCATCATCATCATA
F94 CACTAAATTTGACATCCACAAC
F95 GCCACTAATGATTGAAGGATT
R94 ACCACAACGTAAAAATGTTT
R95 CCACTACGTAGCAATGAAGT
R96 CCTTTAGTTTGCCAATTCAC
R97 CCGAGTCAACTCACTAACAA
R98 TCATTCACAAACTGCAGTAG

García-Moreno et al.

García-Moreno et al. BMC Plant Biology 2012 12:71   doi:10.1186/1471-2229-12-71

Open Data