Table 2

Tomato orthologues of candidate regulatory genes for L-ascorbic acid metabolism
Gene Reference Gene inArabidopsis Unigene Name F-primer (5-3) R-primer (5-3)
    L-galactose pathway
GDP-mannose pyrophosphorylase At2g39770 SGN-U568548 SlGMP1 CAGGTAGCATTATCGGTTGG TTGATCTCCTTGTGGGGTAA
SGN-U568547 SlGMP2 GTGTAGTTTTGCCCCACAAG AGGAGAACTGGAAACCAACC
SGN-U584300 SlGMP3 AGAAGCGACTGGGAGAGTTG GAATCCGGTCCAAAACAGAA
GDP-mannose-3,5-epimerase At5g28840 SGN-U581327 SlGME1 TTCCTGTCCAACACATTCCT CTTTCTCGATCTGCTCCTTG
SGN-U580362 SlGME2 ATTCGAGATGTGGGGAGATG GGAAGGTTCTTGCCATCAAA
GDP-L-galactose phosphorylase At4g26850 SGN-U579800 SlGGP1 TCCAAGTGTCGTTGCCATAA TCGGAAGTAAGGGTTTGCTG
SGN-U573852 SlGGP2 GCTCTCCATTTTGCCAGAGA CCCCTTCCTTGCCAGTATTT
L-galactose-1-P-phosphatase At3g02870 SGN-U600217 SlGPP1 TGGTGGCGCTGTAATAGTGA AACGCTTCCTTGAGATGAGG
SGN-U568299 SlGPP2 AGGTCCCTTCGTATGTGTGG GAACCCTCCAGCTTCTTTCA
L-galactose dehydrogenase At4g33670 SGN-U565558 SlGalDH AGTAGCAACGACTGGAATGG TGCACAACAGGAGATCACAA
L-galactonolactone dehydrogenase At3g47930 SGN-U585649 SlGLDH AGATTGAGGTTCCCAAGGAC TTAGATAGGATGCGGTTTGG
    AsA recycling pathway
Monodehydroascorbate reductase At1g63940 SGN-U583672 SlMDHAR1 CAAGGGTTTCGGTTCCTTCT CTGCATTTCCTCCTCCAACT
At3g52880 SGN-U573751 SlMDHAR2 AGATCGTTGGTGCATTCCTC AAAACTGATGCCCTCCTGTG
At3g27820 SGN-U584073 SlMDHAR3 AGGAATGGAATGTGCTGCTT GACCGTGCCTTTCACAAACT
Dehydroascorbate reductase At1g19570 SGN-U583361 SlDHAR1 AGGTGGCTCTTGGACACTTC CTTCAGCCTTGGTTTTCTGG
At5g16710 SGN-U577467 SlDHAR2 CACCCAGAGGGTTTTGCTTA CTCCAGTGCCTGTGAGATGA

Details of the gene ID, the corresponding unigene, and the forward and reverse primers used in gene expression studies throughout ripening are shown.

Mellidou et al.

Mellidou et al. BMC Plant Biology 2012 12:239   doi:10.1186/1471-2229-12-239

Open Data