Table 4

Sequence information for primers used for polymorphism and BnFLC.A10 gene expression analysis
Primer name Sequence(5'-3')
BnFLC.A10 specific primers
Exon1-2 f CATCCGTCGCTCTTCTTGTC
Exon1-2 r GTTGCTTTCCATATCGATCAAG
Exon2-4 f AACATGATGATGATCTTAAAGCCT
Exon2-4 r CTCCAGCTGAACCAGGGAAC
Exon4-7 f CTTGAGGAATCAAATGTCGATAA
Exon4-7 r CGGAGATTTGTCCTGGTGAG
InDel1 f (P4 f) GGTTCCTTTTCTTTTCGTTTGGG
InDel1 r (P4 r) GAAGTAAAGTCGGACAAGAAGG
InDel2 f (P5 f) CCTTCTTGTCCGACTTTACTTC
InDel2 r (P5 r) CGTTGCTCCTACTTTGTCTATC
InDel3 (IP1IP2) f CGTCGCTCTTCTTGTCGTCTC
InDel3 (IP1IP2) r TATGCATCACAGCGTGTCAAA
InDel4 f GTGTTCAGCTGTCGCTTCTAT
InDel4 r CTAACGCTGGCTTTGATCTT
Itr1f AATACTTCCTGCGAATCTTGTG
Itr1r AGTTTGCTTCTAAGTCCCCAAT
SSR primers developed from JBnB75D10
25GTTA f ACTTTCATCACCATTGCAGACA
25GTTA r AAGAGCAGCCATTGTATCAGGT
T11 f TTCCCAAGCTTGCTGGTACT
T11 r GAGATTTCCCTCGCTTGATG
NIAB009 f TACGCTAGTGAGAACACCTCCA
NIAB009 r GCTTTAGCAAGAAAACTCGGAA
q-RT PCR primers
Prt f TCCGTCGCTCTTCTTGTCGT
Prt r GCTGAACCAGGGAACCCACA
actin2 F CTGTGCCAATCTACGAGGGTTTC
actin2 R CTTACAATTTCCCGCTCTGCTGT
18S f GAGTATGGTCGCAAGGCTGAAA
18S r CGCTCCACCAACTAAGAACGG

Hou et al.

Hou et al. BMC Plant Biology 2012 12:238   doi:10.1186/1471-2229-12-238

Open Data