Table 1

Primers used for qRT-PCR to validate fold change of microarray hybridization
Probe sets Sense primer 5-3 Anti-sense primer 5-3
259878_at GAACACTTGCTTCTCAACTTATT TCACCAACTCCACCTCCTA
260203_at CACGGTCTTGCGGATACTTCTA CGAGTCAACACCATAACCCTTT
266267_at GAGAAGGGAGTAGAGGTTGC TTTTGATCCATCTGTTTAGC
261037_at GACAATACCCTTACGGTGGCT GCTTCAACAATCTCCGCATCT
264886_at CGCTATCAAATTCACAGG AACAAAGAGCCATCCATAC
261470_at TTACAACATCAACGCCCACT TAACGACATCCATCACCACC
Actin GGAAGGATCTGTACGGTAAC TGTGAACGATTCCTGGACCT

Zhang et al.

Zhang et al. BMC Plant Biology 2012 12:234   doi:10.1186/1471-2229-12-234

Open Data