Table 3

List of primers used
Gene Primer Sequence 5’→3’ Fragment size (bp)
oligo(−dT) anchor primer GACCACGCGTATCGATGTCGAC(T)16V
FNS II FNS1 F CCCAACACCATGAATACACTCC
FNS4 R TCACCACTGAGAGTTCTCTCATGG
FNS II FNSIIRub-ex F CCCAACACCATGAATACA C
R GAAGCGAAGGTAAACACA C
FNS II Dah.FNSII.lang F CAACACCATGAATACACTCCTAGTACTCC
R CTTAGACTGAAGTAAACATCGAATGTGGAGAG
FNS II qPCR F GCATCCAGAATCTCGGCCATT
qPCR R TCGTTGTCACTTCTCGCACTAG
Actin qPCR F GGAAAAGATTTGGCATCACACTTTC 103
qPCR R AGCCTTAGGATTTAAAGGTGCCTCA
GAPDH qPCR F AGGCTGTTGGTAAGGTGTTGC 141
qPCR R GCAGCCTTGATCTGCTCATAAG
CHS1 qPCR F GCGCGTATATGGCACCTTCG 198
qPCR R GGCCGAGGAGCTTGGTGAGT
CHS2 qPCR F ACGTTTCGTGGACCGACGGAT 185
qPCR R CAGCCCCACCTCCCTCAAG
CHI qPCR F ACTTCCCTCCCGGCTCCTCT 182
qPCR R TTGTTTGGCTGCTGGGGAAACAC
FHT qPCR F CCACAGCCCGACCTGACACT 202
qPCR R CGTTCTTGAACCGCCCATTG
DFR qPCR F GCCAAAGCCAAGACGGTCAA 192
qPCR R CGTTGCCTTCCATGCTGCTT
ANS qPCR F GCTGCAGGCGAGGGTTTCTT 119
qPCR R GTCGACGGCCAAATGGTGAG
F3’H qPCR F AACTGCCTTGCTATTGTACGTACTG 147
qPCR R TTTTCCGCCAGGGCTGCC
MaT qPCR F TTGGAATATGCCGACCGATG 112
qPCR R CCTTTCCCCACCCAAAATCA
Delila qPCR F ATCTCACAAACGCCGAGTGGTATT 158
qPCR R TGCTAGAAGAGAGCGGCAGAAGA
IVS qPCR F CGTCGTCGAGAGAAGCTAAACGA 151
qPCR R GACATCGTGCTTCCAAATCCTGAA
MYB1 qPCR F TTGAGGAAAGGTTCATGGTCAGC 145
qPCR R AATTTGTCCATCGTAGCCTGCAAC
MYB2 qPCR F ACCCTCCTCCAACCACTCATCAT 160
qPCR R TGAGGTGGGCTCATTCTCAACTC
R3MYB qPCR F ATGGCCGTGAGAAGGAAATTGATG 153
qPCR R CAAGGAGGTCCAACATGACAAC
WDR1 qPCR F CGGTTGCGGAACTAGAGAGAC 155
qPCR R TGACATCGGGTCAATCCCATTAGG
WDR2 qPCR F CAGAGGCATCAGTCGAGTGTGA 149
qPCR R GCCAATATCGGATCCAATCCACCT

Abbrev.: F: forward, R: reverse.

Thill et al.

Thill et al. BMC Plant Biology 2012 12:225   doi:10.1186/1471-2229-12-225

Open Data