Table 1

Primers designed for amplification and mapping of the candidate genes
Primer Sequence 5’-3’ Primer Sequence 5’-3’
GGPPS1-F1 GCCAGCGTCGACTCCTAC PSY3-F TCGACGAGCTGTACCTCTACTG
GGPPS1-R1 GGAACAGCAACCCAATTGAT PSY3-R CTCGATCTCGTCCAGGATCT
GGPPS1-spF CGTATGCCTTTCTAAGAAGTG HYD3-F3 CCTCCGTGTACTACCGCTTC
GGPPS1-spR GGAGATACCTATGCAAATCAT HYD3-R2 CGAACTTGTCCATGTGGTGT
DXR-F1 GAGCATGGGGAAGAAAATCA ZDS-F2 TGTCCCAGGGATCAAAAGAC
DXR-R1 GGTGACCTCGGAGCAATAGA ZDS-R2 AGCTTGGATCAGGGAACCTT
HDR-F2 GGCATTGCAAATCAAACAAC LBC-F2 CAAGCTCAAGTCCACCATGA
HDR-R2 TTTCCTGGTCCAATCCTTTG LBC-R2 TGTCTAGAAACCGCACGATG
LEC-F2 CTGGACAATATTTGCCTGGAA LBC-spF GCGACTCCCACCTCCCT
LEC-R2 GGAGGTGTCTGACGAGGTTC LBC-spR GATCGCGGACCCCTCG
PDS-F1 TACAGGTCGTGATTGCTGGT CCD-F1 TTGATCCTACAAAGAAAGCTCGT
PDS-R1 GGGAAATCAAAACGGCTGTA CCD-R1 CAGCTCATTCCCGAAGTTCT
PSY2-F ATTGCTCCGGACTCAAAGG CCD-spR GAAGTTCTCCAGCTTGTCGG
PSY2-R TTGTAGTCGTTCGCCTCGAT PPO1-F1 AGCTTCGAGCAGCAGTGG
PSY2-spR GAGTCAACAATGCTTGAATGA PPO1-R1 GTGGTGCGCGAAGAAGAT

Rodríguez-Suárez and Atienza

Rodríguez-Suárez and Atienza BMC Plant Biology 2012 12:200   doi:10.1186/1471-2229-12-200

Open Data