Table 3

Stress related gene primers used for qRT-PCR in SaSce9 transgenic Arabidopsis plants
Primer name Sequence (5’-3’)
AtTUBRTF ATAACCGTTTCAAATTCTCTCTCTC
AtTUBRTR TGCAAATCGTTCTCTCCTTG
AtRD22F GATTCGTCTTCCTCTGATCTG
AtRD22R TGGGTGTTAACGTTTACTCCG
AtP5CSF GAGGGGGTATGACTGCAAAA
AtP5CSR AACAGGAACGCCACCATAAG
AtNHX1F CCGTGCATTACTACTGGAGACAAT
AtNHX1R GTACAAAGCCACGACCTCCAA
AtSOS1F TCGTTTCAGCCAAATCAGAAAGT
AtSOS1R TTTGCCTTGTGCTGCTTTCC
AtSOD1F TCAACTGGAAATATGCAAGCGAGGT
AtSOD1R ACCACACAGCTGAGTTGAGCAAA
AtCATF AGCGCTTTCGGAGCCTCGTG
AtCATR GGCCTCACGTTAAGACGAGTTGC

Karan and Subudhi

Karan and Subudhi BMC Plant Biology 2012 12:187   doi:10.1186/1471-2229-12-187

Open Data