Table 1

Abiotic stress-regulated miRNAs identified in rice inflorescences
MiRNA Family *Log2 (Drought/Ctrl) *Log2 (Cold/Ctrl) *Log2 (Salt/Ctrl) Putative target
AAUUCACAGGCCCUAUCUUGUG miR1428 −2.71 −0.82 −0.15 Cytochrome c
CUUGGAUUGAAGGGAGCUCU miR159 0.03 0.99 −1.57 MYB family transcription factor
UGCCUGGCUCCCUGUAUGCCA miR160 0.28 0.29 −1.07 Auxin response factor
UGCCUGGCUCCCUGAAUGCCA miR160 1.40 0.60 −0.37 Auxin response factor
GGAAUGUUGUCUGGCUCGGGG miR166 −1.69 −0.65 −0.96 START domain containing protein
GGAAUGUUGUCUGGUCCGAGA miR166 −2.68 0.08 −0.63 START domain containing protein
UGAAGCUGCCAGCAUGAUCUA miR167 1.02 0.81 −0.79 Auxin response factor
UAUGCGUAAGACGGAUUCGUA miR1856 0.72 1.29 0.95
GAGGGAUUUUGCGGGAAUUUCACG miR1866 −4.67 −7.00 −1.49 Hypotethical protein
UUCAGUUUCCUCUAAUAUCUCG miR2275d 1.46 1.62 0.09
CUUGUUUUUCUCCAAUAUCUCA miR2275e 1.37 1.83 0.15
AUUGUUUUUCUCCAAUAUCUCA miR2275c 1.32 1.32 −0.02
UAUUUUAGUUUCUAUGGUCAC miR2871 1.12 1.96 1.56 Glycosyltransferase family protein
UUGGACUGAAGGGUGCUCCC miR319 −0.46 −0.09 −1.46 TCP family transcription factor
UCCAAAGGGAUCGCAUUGAUC miR393 1.26 0.98 0.55 F-box domain and LRR containing protein
UCAGUGCAAUCCCUUUGGAAU miR393 0.99 1.08 0.21 MYB family transcription factor
UUGGCAUUCUGUCCACCUCC miR394 0.21 1.19 −2.94 F-box domain containing protein
UUCCACAGCUUUCUUGAACUG miR396 0.69 1.09 0.34 Growth regulating factor
UUCCACAGCUUUCUUGAACUU miR396 1.03 2.09 −0.14 Growth regulating factor
UCCACAGGCUUUCUUGAACUG miR396 1.17 1.32 0.06 Growth-regulating factor
UGGAAGGGGCAUGCAGAGGAG miR528 −0.70 −0.46 −1.39 Plastocyanin-like domain containing protein
AGAAGAGAGAGAGUACAGCCU miR529 1.41 1.35 0.79 SBP-box gene family
AGGUGCAGAGGCAGAUGCAAC miR530-3p −2.23 1.09 −2.06 Hairpin-induced protein 1 domain containing protein
UUGCUCUGAUACCAAUUGUCGG osa-cand027 2.35 0.60 −0.72
GAAGCUGCAGCUGUCAGAAGCUCC osa-cand032 −0.01 −0.64 −1.18
AAUGGCUUGUCUUGUUUUGUGUGC osa-cand042 −0.62 −2.82 −1.24
UACAACUUCUUGUUGAUGGAAACU osa-cand052 −3.66 −7.49 −0.92
UAAAUGGAGAGAACGAAAGAG osa-cand056 1.25 0.96 0.32

*Log2 ratio of normalized miRNA expression in stress and control libraries. Ctrl: control condition; ↑ and ↓: up- and downregulated in stress, respectively.

Barrera-Figueroa et al.

Barrera-Figueroa et al. BMC Plant Biology 2012 12:132   doi:10.1186/1471-2229-12-132

Open Data