Table 1

The top 10 novel miRNAs predicted from both arms of the miRNA precursor

miRID

Location

Strand

(+/-)

Energy (kcal/mol)

Sequence of 5p

Sequence of 3p

Mock (count)

Drought (count)

Salinity (count)

Alkalinity (count)


5p

3p

5p

3p

5p

3p

5p

3p


Gma-m001

Gm18:61442586:61442692

-

-44.1

CTGACAGAAGATAGAGAGCAC

-

3395

-

3248

-

4830

-

2216

-

Gma-m002

Gm02:837420:837549

+

-56.5

CAGGGGAACAGGCAGAGCATG

-

3672

-

2573

-

2945

-

3159

-

Gma-m003

Gm12:3176108:3176377

+

-69.67

TCCATTGTCGTCCAGCGGTTA

-

3282

-

3673

-

2931

-

1186

-

Gma-m004

Gm19:40699070:40699221

-

-65.8

TGGGTGAGAGAAACGCGTATC

TACGGGTCGCTCTCACCTAGG

367

879

491

1053

186

1083

125

329

Gma-m005

Gm14:5324794:5324912

+

-44

AGCCAAGAATGACTTGCCGGAA

CGGGCAAGTTGTTTTTGGCTAC

337

560

475

644

438

471

175

173

Gma-m006

Gm09:16565920:16566038

-

-44.7

AGAGGTGTTTGGGATGAGAGA

CCTCATTCCAAACATCATCTAA

1596

102

1695

138

777

128

335

53

Gma-m007

Gm18:61452908:61452997

-

-41

GGAATGGGCTGATTGGGAAGT

-

835

-

781

-

813

-

598

-

Gma-m008

Gm02:30498945:30499130

-

-70.5

CTGGGTGAGAGAAACACGTAT

ACGGGTCGCTCTCACCTGGAG

85

665

170

635

78

714

43

264

Gma-m009

Gm13:34382988:34383131

-

-57.37

TCATTGAGTGCAGCGTTGATG

TATTGACGCTGCACTCAATCA

332

811

187

744

202

340

142

227

Gma-m010

Gm06:10859290:10859391

-

-33.76

-

CGAGCCGAATCAATACCACTC

-

658

-

693

-

515

-

355


Li et al. BMC Plant Biology 2011 11:170   doi:10.1186/1471-2229-11-170

Open Data