Table 2

Sequences of primers used for amplification and sequencing of the CYP85A2 gene

primer name

sequence


AT3G30180-F1

TAAACAACGCCACACACACC


AT3G30180-613R

CAACGAGCCTCTCATTAGCC


AT3G30180-445F

TGGTTGCCCAACAATAGTCTC


AT3G30180-1274R

TCCCACAACAAGCTTGAAAA


AT3G30180-2427F

TTTGGTGCTCTTGTGTTTTG


AT3G30180-3UTRR

CATTGCAAGTAGGCCCAAAT


AT3G30180-2938R

TTCCATTTTCTTCTTCTCTCTTTCTC


Nole-Wilson et al. BMC Plant Biology 2010 10:198   doi:10.1186/1471-2229-10-198

Open Data