Table 3

Primer design for RT-qPCR
Transcript name: Forward: Reverse:
HPRT1 5′-AGACGTTCTAGTCCTGTGGC 5′-TGCAAATCAAAAGGGACGCA
β-actin 5′-GCCTTCCTTCCTGGGTATG 5′-GGTCTTTACGGATGTCAACG
Ywhaz 5′- AGACAGCACGCTAATAATGC 5′- CAGACAAAGGTTGGAAGGC
Rpl13a 5′- CCCTCCACCCTATGACAAG 5′- AGGTAAGCAAACTTTCTGGTAG
Fkbp14 5′- ACGACGACTGGAAACTCTCT 5′- CTGCTTCCCTACAGTTCGTC
Hspb1 5′- GGATCGATGACATGAGCAGC 5′- TGCCAGTAGCCTTCAACTCT
Arid5b 5′- CCGAGACTGTCATCCCAAAG 5′- TTCCGGAAGTTCTCCAGTCT
Cma1 5′- ACCAAAGCTGGGGAGATCAT 5′- ACTGCAGGCTGACAGGTAAT
Sc65 5′- AGGCGAACCGACTAGAGAAG 5′- AAAGTCCCCGCTGTTGTAGA
Rdh10 5′- TCCTGGTCAATAACGCTGGT 5′- TAGTGGTCCAGAAGTGTGCG
Bloc1s2 5′- AACTGACAGCCACCAGTGAA 5′- CCTGCTCCTCAATCACGTTG

Cox-Limpens et al.

Cox-Limpens et al. BMC Neuroscience 2014 15:67   doi:10.1186/1471-2202-15-67

Open Data