Table 1

Primer information
Transcript Accession no. Forward primer Reverse primer Annealing Temp.
H3f3b NM_053985 attcgcaagctcccctttcag tggaagcgcaggtctgttttg 51°C
Rpl19 NM_031103 tcgccaatgccaactctcgtc agcccgggaatggacagtcac 54°C
Actb NM_031144 cactgccgcactctcttcct aaccgctcattgccgatagtg 53°C
Cyclo M19533 gagcgttttgggtccaggaat aatgcccgcaagtcaaagaaa 51°C
Gapdh X02231 acatgccgcctggagaaacct gcccaggatgccctttagtgg 55°C
Sdha NM_130428 gggagtgccgtggtgtcattg ttcgcccatagccccagtag 53°C
Tubb5 NM173102 cggaaggaggcggagagc agggtgcccatgccagagc 57°C
Slc6a17 NM_001033079 cagttacaacaaggacaacaac ctgaccagaagggagatgc 53°C
Slc6a15 NM_172321 tgcatggatcaaggagaaggc gcgacgaatgaaaacgactgg 58°C

Hägglund et al.

Hägglund et al. BMC Neuroscience 2013 14:54   doi:10.1186/1471-2202-14-54

Open Data