Table 2

Primers used in ChIP-qPCR analysis

Gene

Forward primer

Reverse primer


nanog -1524/-1373

AGAGGCAGACAGTGGTGACGA

CCACAGCCACCATACTACTACTG


nanog -951/-782

GGCAAACTTTGAACTTGGGATGTGGAAATA

CTCAGCCGTCTAAGCAATGGAAGAAGAAAT


nanog -545/-365

GCTCTTTCTTCAGACTTGCGTT

GAGTTTCCTCTTCCATTCTTTCTAC


nanog -252/+17

GGGGATGTCTTTAGATCAGAGG

CCAAATCAGCCTATCTGAAGG


nanog +1079/+1317

TGTCCCCTTTTTTCTGAGCTT

CACTTTTCCCACCTCCAAAAT


oct3/4 -2063/-1894

GGAACTGGGTGTGGGGAGGTTGTA

AGCAGATTAAGGAAGGGCTAGGACGAGAG


oct3/4 -1377/-1129

TGCTCTGGGCTTTTTGAGGCTGTGTGATT

TGGCGGAAAGACACTAAGGAGACGGGATT


oct3/4 -620/-378

TCTACCAACCTGGACAACACAAGATGGAA

GCCACTCCTCAGTTCTTGCTTACCCAC


oct3/4 -237/+22

GTGAGGTGTCCGGTGACCCAAGGCAG

CGGCTCACCTAGGGACGGTTTCACC


oct3/4 +1310/+1513

GGAGTCCCCTAGGAAGGCATTAATAGTTT

GGATTCTCTCGGCTTCAGACAGACTTT


Yan et al. BMC Neuroscience 2012 13:6   doi:10.1186/1471-2202-13-6

Open Data