Table 1

Primers used in q-RT-PCR analysis

Gene

Forward primer

Reverse primer


ngn1

CCCTGAAGACGAGGTGAAAAGT

CTTGCCATTGTATTGTCAGCCG


mash1

TAACTCCCAACCACTAACAGGC

TGAGGAAAGACATCAACCCAGT


neuroD

TTCCACGTCAAGCCGC

TCGGCGGATGGTTCGT


sox2

CCACCAATCCCATCCA

ACCGCCTAACGTACCACT


oct3/4

TCACTCACATCGCCAATCA

GTAGCCTCATACTCTTCTCGTT


nanog

GGCAGCCCTGATTCTTCTAC

CGCTTGCACTTCATCCTTT


lin28

CGGCCAAAAGGGAAGAACAT

CATTCCTTGGCATGATGGTCT


fgf4

GGCTTCGGCGGCTCTACT

AGGATTCGTAGGCGTTGTAGTTG


utf1

TCCTCTTACGAGCACCGACAC

GCAACGCGGTATTCAACGA


gata6

AACAGCAGTGGCTCTGTCCC

CTCGGGGTTGGCGTTTT


sox17

TGGGCCAAAGACGAACG

TTGGGGTGGTCCTGCATAT


hand1

CTACTTGATGGACGTGCTGG

CAACTCCCTTTTCCGCTTG


brachyury

CCAGTCTCTGGTCTGTGAGCA

GGGGAGCCTCGAAAGAA


pax6

GTGAATGGGCGGAGTTATG

ACTTGGACGGGAACTGACA


nestin

TGAGAACTCTCGCTTGCAGAC

GTATCCCAAGGAAATGCAGC


bmp4

CGAGCCAACACTGTGAGGA

GAGGTTGAAGAGGAAACGAAA


cdx2

TCAGGAGGAAAAGTGAGCTG

GGCTGTGGAGGCTGTTGTT


gapdh

GAAGGTGAAGGTCGGAGTC

GAAGATGGTGATGGGATTT


Yan et al. BMC Neuroscience 2012 13:6   doi:10.1186/1471-2202-13-6

Open Data