Table 1

Primers used in this study

Primers for HTR2C amplification

forward

reverse

template

size (bp)


Exon 1

TTTAGCCCAAGAGAGCGATG

TAGGGTCTGGGCTAGCAATG

genomic

637

Exon 2

TTCTGGCACTAATGAATATCAGC

CATGGTAAGTCAATAACGTCAAATG

genomic

315

Exon 3

CTGCATCCCCATTATGAGC

TGGACCTTTCCTTGCATCTC

genomic

300

Exon 4

AAATGAAAAATCTATCCTCTTTGC

GGCAGATTGAGGCAAATATAGC

genomic

413

Exon 5A

ACTCTGGGGACAGGAGGAAG

CTGCCATGATGACGAGAATG

genomic

400

Exon 5B

ATGGTGGACGCTTCAAATTC

TGCGCACATTCAATTACCTC

genomic

363

Exon 6

GCCCTAGAAAAGGCAAAATG

TAGCCGCTGCAATTCTACTG

genomic

463

Exon 7A

ACCCTTCCGTGTGCTGTAAC

CAAGCCTTCCCACAAAGAAC

genomic

519

Exon 7B

GAAAGCGTCGAAAGTCCTTG

TCAACATTTTTGCATCGAAC

genomic/cDNA

695

HTR2CX1-2

TTTAGCCCAAGAGAGCGATG

TTGAAGGATGGGGATTCTTG

cDNA

653

HTR2CX2-5

GTAGGCCAAGAATCCCCATC

ACCAATAGGCCAATCAGGTG

cDNA

263

HTR2CX4-5

CATGGTGAACCTGAGGAAAG

GCAGAGACAGTGGCATGA

cDNA

335

HTR2CX5-7

CATGCCACTGTCTCTGCTTG

TGTTGTTGACGAACACCTTG

cDNA

299/204

HTR2CNR

TTGCCCAAACAATAGCAATC

cDNA

HTR2CL

TTCTACAGCGTCCATCATGC

CACCTAAAGAAATTGCCCAAAC

qRT-PCR

143

HTR2CS

TGTCATGCCACTGTCTCTGC

ACACCGATCCAGCGAAATAG

qRT-PCR

145


A list of primers used for PCR amplification of HTR2C exons from both genomic DNA, and cDNA prepared from a transcript pool. Primers were selected following comparison of human and porcine reference sequences to define the putative coding regions of the pig genome

Quilter et al. BMC Neuroscience 2012 13:37   doi:10.1186/1471-2202-13-37

Open Data