Table 1

Primers used to construct luciferase reporter plasmids of Nestin
Gene name Primer sequence Product size (bp)
Nestin 3’UTR Forward/ SpeI: 5'- GGACTAGTGAAAAGACCATCTG -3' 431
(mir-125b sense) Reverse/ SphI:5'- ACATGCATGCAGGGCGTGCTACTG -3'
Nestin 3’UTR Forward/ SpeI: 5’- GCACTGCCGACTTACGGGTGCGGGGAGGGGA -3’ 431
(mir-125b mutated 1 putative binding region) Reverse/ SphI:5'- CACCCGTAAGTCGGCAGTGCCGGGCAGATGG -3'
Nestin 3’UTR Forward/ SpeI: 5’- TGGCTGACAGGGCTGGCCGGCTAAGGTGAAA -3’ 431
(mir-125b mutated 2 putative binding region) Reverse/ SphI: 5'- CCGGCCAGCCCTGTCAGCCAGAAACCATATGTCAA -3'
ACTB 3’UTR Forward/ SpeI: 5'- GGACTAGTGCGGACTATGACTTAGTTGC-3' 563
Reverse/ SphI: 5'- ACATGCATGCAAGTCAGTGTACAGGTAAGC-3'

Cui et al.

Cui et al. BMC Neuroscience 2012 13:116   doi:10.1186/1471-2202-13-116

Open Data