Table 6

Primer sequences of Danio rerio genes used in qRT-PCR for validation of microarray data.

Symbol

ID

Direction

Primer Sequence

PCR


ef1alpa

NM_131263

forward

CGACAAGAGAACCATCGAGAAGTT

Taqman

reverse

CCCAGGCGTACTTGAAGGA

Taqman


gh1

AY286447

forward

Applied Biosystems Assay ID:

Taqman

reverse

Dr03128643_m1

Taqman


junb

NM_213556

forward

Applied Biosystems Assay ID:

Taqman

reverse

Dr03204057_s1

Taqman


atoh1a

NM_131091

forward

GGCAGATGAGGGCAGACA

Taqman

reverse

CCTCTGTTTCTGCACGACGTT

Taqman


rb1

BC154730

forward

GCCCCTCCATCACAACCA

Taqman

reverse

GGCTCGGCCTCCATTACAG

Taqman


cdkn1b

NM_212792

forward

GAGAGCCGAGGAAAAGAAGCT

Taqman

reverse

GCGAGCGTTTGCTTTGACA

Taqman


smyhc1l

AF425742

forward

TGAGCAACTTGGTGAGAGTGGGAA

Sybr green

reverse

TCAGCTTCCTCCAGAGCAGTTTGT

Sybr green


zgc:66286

AF434191

forward

TTCCTGCCAATGCATCAGCACAT

Sybr green

reverse

CCGTTGCCCTCTTTGTCAAACACT

Sybr green


mhc1ze

NM_194425

forward

AGAGTGTGTGGACTGGCTCAACAA

Sybr green

reverse

AGAATCCAGTGGCCAGACAAGTGA

Sybr green


ppia

NM_212758

forward

AGAATTTCAGGCAGTTGTGCACGG

Sybr green

reverse

TGTGGTTTGTGAAGTCACCTCCCT

Sybr green


Schuck et al. BMC Neuroscience 2011 12:88   doi:10.1186/1471-2202-12-88

Open Data