Table 2

Primer pairs used for qRT-PCR expression analysis

    Gene

    Forward primer

    Reverse primer


Ascl1

AACCGGGTCAAGTTGGTCAA

CGTCTCCACCTTGCTCATCTTC

Ccnd1

AGAGGGCTGTCGGCGCAGTA

GGCTGTGGTCTCGGTTGGGC

Cdk2

TGCTGAAATGGTGACCCGCAG

TGCCGAGCCCACTTGGGGAA

Cdk4

GGTGTATGGCGCCGCAGGAA

GCAGGGGATCTTACGCTCGGC

p21 (Cdkn1a)

TCCAGGAGGCCCGAGAACGG

CTCCGAACGCGCTCCCAGAC

p27 (Cdkn1b)

GCACTGTGGAGCAGACGCCC

TCTGCCAGCAGTCCTGGGGT

p57 (Cdkn1c)

CCAATCAGCCAGCCTTCGACCA

CAGGCGCTGCTACGCGCTAT

Ctnnb1

AGGCGAACGGCATTCTGGGC

ACGCACCGTCCTTCGTGCTG

Gli1

GCTTGGATGAAGGACCTTGTG

GCTGATCCAGCCTAAGGTTCTC

Hes1

TGGCGGCTTCCAAGTGGTGC

GATGACCGGGCCGCTGTGAG

Hes5

GCCTGGAGCGGACCAGAGGA

CAGCCGGAGGAGGGAGCCTT

c-Myc

ACCCGCTCAACGACAGCAGC

CCGTGGGGAGGACTCGGAGG

Neurod1

CCGCCACACGCCTACA

CAAACTCGGCGGATGG

Neurog1

GACCTGCATCTCTGATCTCG

TGTAGCCTGGCACAGTCCTC

Olig2

CTCCGACGCCAAGTGAGCCG

AATCCCCTAGGCCCAGCCCG

Pax6

AAGCAACAGATGGGCG

GCTTCATCCGAGTCTTC

Shh

CACCCCCAATTACAACCCCGACA

TCCAGGCCACTGGTTCATCACAGA

Sox1

CTGGGCGCCCTCGGATCTCT

GGACACGGTGCCCGTGAGTG

Sox2

GAAAGAAAGGAGAGAAGTTTGGAG

ATCTGGCGGAGAATAGTTGGG

Sox9

TCGGTGAAGAACGGACAAGC

TGAGATTGCCCAGAGTGCTCG

Tcf4

TGGAGGCCATCCAAGCCCGT

TGCTGGTGGCAACCCTGAACG


Zhou et al. BMC Neuroscience 2011 12:50   doi:10.1186/1471-2202-12-50

Open Data