Table 2

Primer sequences used in the experiment

mRNA

Accession no.a

primer sequence

Start position b

Product sizec


ChAT

(first round)

XM_001061520

CAGGAAGGTCGGGTGGACAACATC

TCCTTGGGTGCTGGTGGCTTG

1675

2198

524 bp

GAD67

(first round)

NM_017007

TTTGGATATCATTGGTTTAGCTGGCGAAT

TTTTTGCCTCTAAATCAGCTGGAATTATCT

762

1162

401 bp

VGLUT1

(first round)

NM_053859

TACTGGAGAAGCGGCAGGAAGG

CCAGAAAAAGGAGCCATGTATGAGG

188

498

311 bp

VGLUT2

(first round)

NM_053427

CCCGCAAAGCATCCAACCA

TGAGAGTAGCCAACAACCAGAAGCA

1264

1682

419 bp

Nestin

(first round)

M34384

CTCGGGAGTGTCGCTTAGAG

ATTAGGCAAGGGGGAAGGGA

783

1216

434 bp

ChAT

(second round)

XM_001061520

ATGGCCATTGACAACCATCTTCTG

CCTTGAACTGCAGAGGTCTCTCAT

1840

2163

324 bp

GAD67

(second round)

NM_017007

CTGACATCAACTGCCAATACCAA

GGAGAAAATATCCCATCACCATC

793

929

137 bp

VGLUT1

(second round)

NM_053859

GTGGTGGACTGCACTTGCTT

CATGTATGAGGCCGACAGTCTC

274

484

211 bp

VGLUT2

(second round)

NM_053427

CGCAAAGCATCCAACCAT

TGTGGGACCGCAGACAAC

1266

1529

264 bp

Nestin

(second round)

M34384

GGA GCA GGA GAA GCA AGG

GGT CCA GAA AGC CAA GAG

931

1115

185 bp


ChAT, choline acetyltransferase; GAD, glutamic acid decarboxylases; VGLUT, vesicular glutamate transporter. a The GenBank accession number for the cDNA sequence used in primer design; b The cDNA position of the 5'' end of primer; c Expected PCR product length.

Zhu et al. BMC Neuroscience 2011 12:129   doi:10.1186/1471-2202-12-129

Open Data