Table 2

Accession number, DNA sequence, and product sizes of primers for Kainate receptor subunits and VGLUTs.

Gene

Accession #

Forward Primer (5'→3')

Reverse Primer (5'→3')

Product (bp)


GluR5

NM_010348

TGCCTAGGAGTCAGTTGTGTGCTT

AGTGAGGTTGCAGTTCCTCTGTGT

549


GluR6

NM_010349

GTGCCATCTTGGATTTGGTGCAGT

ACATCAGAGCAGCATCAGTCGTCA

498


GluR7

NM_001081097

TCACACAGAGGAACTGCAACCTCA

TGATAACCGCATCCGTCTTGACCA

441


KA1

NM_175481

TGCTTCCTGCTTGGCTCTTGAT

AGGCATTCTGCTTTGGCACA

487


KA2

NM_008168

TGATGCCAATGCGTCCATCT

ATGTTGAGGCTGCGCACAAA

210


VGlut1

NM_182993

ACCTGTTCTGGTTGCTTGTCTCCT

GTTCATGAGCTTTCGCACGTTGGT

398


VGlut2

NM_080853

AGCCTGTCATGGGATATGGAGCAA

ATTATCGCGTAGACGGGCATGGAT

360


VGlut3

NM_182959

TCACATCCTTGCCTGTCTATGCCA

TGAGGAACACATTCTGCCACTCCT

525


Vandenbeuch et al. BMC Neuroscience 2010 11:77   doi:10.1186/1471-2202-11-77

Open Data