Table 2

PCR Primers

Gene Symbol

Accession #

Left Primer

Right Primer

Product Size


Abcb5

XM_234725

CTGATAGAGCATGGCTTTGAATG

GGTTGTTTTATGGCAGAGCAGA

77

Akt3

NM_031575

TGGAGAGGAAGAGATGGATGC

TCCACTTGCCTTCTCTCGAAC

130

Arg1

NM_017134

TGGAACAATCAGTGTGGTGCT

ATCCACCCAAATGACGCATAG

103

Atf3

NM_012912

AATTGCTGCTGCCAAGTGTC

CAGTTCGGCATTCACACTCTC

94

Atg9a

NM_001014218

CCTTTGCGCAGATGGACGTT

ACAACTCGGTCTTCCCATCCT

107

Atg9b

XM_575327

CATTCTACCCTCAGCCCAGT

GAAGAGATTGCAGACCGAGC

121

Atrn

NM_031351

CGTGTGGTCATGTTGGTCA

GCACTAGAGCACCTTGAGTTTG

121

Casp2

NM_022522

GTGGAATGCATCCTGACCAT

TAACAGTTCGCTCAGCAGCA

83

Crem

S67786

CTGGCCAAATTTCTGTCCCTA

ACACCTTGTGGCAAAGCAGTA

133

Dbh

NM_013158

GGGATGTCCTCATCACTTCG

GTGGCCATTGTCCTGTTTTC

55

Flna

XM_238167

ACCAACCAACAGTGCAGACC

TGTTTGCTGGCTACCCTGAG

80

Fuk

XM_226508

AGAGCTCAGGCTCTAGGATGC

ACACCACCCATTGCCTATGA

112

Grm4

NM_022666

CCAATGTGCCATCCTCAGA

CCTACACCAACCATGCCATC

119

Itga6

XM_215984

GCCCTATGAACTTGGTGGAGA

AATACCCTTCCCTGAGTCCACA

100

Itgb1

NM_017022

CCACAACAGCTGCTTCTAAAGTTG

AATAGGGTAGTCTTCAGCCCTCTTG

84

Maob

NM_013198

TGGTGGATCTGGTCAAGTGAG

TCTCCTGTCTGGTCAATGTGG

96

Notch3

NM_008716

TGCAGGGTAGGCTTGGTATG

TGTGTCCAGACTGGGGCTTA

79

Nrap

NM_001107443

GGCGGCTCTTTTGGCTATC

GGGCAGCAGAGAGGGAAAG

72

Oaz1

NM_139081

AGTCAGCGGGATCACAGTCTT

AGGACCCTGGTCTTGTCGTTA

98

Pdgfra

XM_214030

CGAAGGCAGGCACATTTATATC

TATGATGGCACAATCGTCCTCT

109

Pycard

NM_172322

GCATACAGGAGCTGGCTGA

CAATGAGTGCTTGCCTGTGT

135

Rhoq

NM_053522

CTATGCTAACGACGCCTTCC

GATAAAGGCCTCAGACGATCA

147

Sat

NM_001007667

TGACCCATGGATTGGCAAGT

GCAGCGACACTTCATAGCAA

124

Slc27a3

XM_215605

CAGCTCCCCAATGTACTGGA

TAGGGGCCACTGTGGTACTG

101

Slc6a11

NM_024372

CCCGTCTTCTTCCTGGAAAC

GGACAGACTCTCCTCCAGCA

77

Tgfbr1

NM_012775

TTCATTTCAGAGGGCACCAC

CAATGGTCCTTGCAATTGTTC

109

Xiap

NM_022231

GAATATGACGCACGGATCGTT

CCTCCTCCACAGTGAAAGCAC

128

Zfp53

XM_344861

GCAAACAAGCTGCAGAGTCA

TGAGGCGGTACTGAAGCATT

132


PCR Primer Table. Primer sequences for all of the custom designed PCR primers used in this study. Primers were designed using the Primer3 software and synthesized by Eurofins MWG Operon (see Methods)

Siebert et al. BMC Neuroscience 2010 11:148   doi:10.1186/1471-2202-11-148

Open Data