Table 2

PCR primers used in this study

Primer/application

Sequence


BAC modification


hBDNFcod_rpsL_neo_s

5' GGATAGACACTTCTTGTGTATGTACATTGACCATTAAA AGGGGAAGATAGGGCCTGGTGATGATGGCGGGATCG 3'


hBDNF_rpsL_neo_as

5'AATAGATAATTTTTGTCTCAATATAATCTAATCTATACAACATAAATCCATCAGAAGAACTCGTCAAGAAGG 3'


hBDNFcod_linker_EGFP_s

5' TAAGGATAGACACTTCTTGTGTATGTACATTGACCAT TAAAAGGGGAAGACGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTG 3'


hBDNF_EGFP_as

5' AATAGATAATTTTTGTCTCAATATAATCTAATCTATAC AACATAAATCCATTACTTGTACAGCTCGTCCATGCCGA 3'


genotyping/slot-blot hybridization/expression analysis


hBDNF_s

GTACGTGCGGGCCCTTACCATGGATAGC


EGFP_as

TGGTGCAGATGAACTTCAGGGTCAGC


expression analysis


mBDNF_s

GTATGTTCGGGCCCTTACTATGGATAGC


mBDNF_as

AAGTTGTGCGCAAATGACTGTTTC


HPRT1_s

CTTTGCTGACCTGCTGGATTAC


HPRT1_as

GTCCTTTTCACCAGCAAGCTTG


hBDNF_I_s

GATGCCAGTTGCTTTGTCTTCTGTAG


hBDNF_II_s

GGGCGATAGGAGTCCATTCAGCACC


hBDNF_III_s

AGTTTCGGGCGCTGGCTTAGAG


hBDNF_IV_s

GCTGCAGAACAGAAGGAGTACA


hBDNF_V_s

TCGCGTTCGCAAGCTCCGTAGTG


hBDNF_Vh_s

GGCTGGAACACCCCTCGAA


hBDNF_VI_s

GGCTTTAATGAGACACCCACCGC


hBDNF_VII_s

GAACTGAAAGGGTCTGCGACACTCT


hBDNF_IXb_s

GCTGCTAAAGTGGGAAGAAGG


hBDNF_IX_as1

GTCCTCATCCAACAGCTCTTCTATC


hBDNF_IX_as2 (with VII_s)

GAAGTGTACAAGTCCGCGTCCTTA


expression analyis (qPCR)


EGFPq_s

CAGAAGAACGGCATCAAGGTG


EGFPq_as

TGGGTGCTCAGGTAGTGGTTG


hBDNFq_I_s

CAGCATCTGTTGGGGAGACGAGA


hBDNFq_IV_s

GAAGTCTTTCCCGGAGCAGCT


hBDNFq_VI_s

ATCGGAACCACGATGTGACT


hBDNFq_IXc_s

AACCTTGACCCTGCAGAATGGCCT


hBDNFq_IX_as1 (with I, IV_s)

ATGGGGGCAGCCTTCATGCA


hBDNFq_IX_as2 (with VI_s)

ACCTTGTCCTCGGATGTTTG


hBDNFq_IX_as3 (with IXc_s)

GATGGTCATCACTCTTCTCACCT


mBDNFq_I_s

TTGAAGCTTTGCGGATATTGCG


mBDNFq_IV_s

GAAATATATAGTAAGAGTCTAGAACCTTG


mBDNFq_VI_s

GCTTTGTGTGGACCCTGAGTTC


mBDNFq_IXa_s

GGACTATGCTGCTGACTTGAAAGGA


mBDNFq_IX_as1 (with I, IV, VIs)

AAGTTGCCTTGTCCGTGGAC


mBDNFq_IX_as2 (with IXa_s)

GAGTAAACGGTTTCTAAGCAAGTG


mBDNFq_coding_s

GGCCCAACGAAGAAAACCAT


mBDNFq_coding_s

AGCATCACCCGGGAAGTGT


HPRT1q_s

CAGTCCCAGCGTCGTGATTA


HPRT1q_as

AGCAAGTCTTTCAGTCCTGTC


transgene integrity


pBACe3.6_SP6 (5'end)

TATTTAGGTGACACTATAG


rp11_5'_as (5'end)

GGACAACAGACCCAAGGAGA


rp11_3'_s (3'end)

GTAGGGTGTCTGGGTTGGTG


pBACe3.6_T7 (3'end)

TAATACGACTCACTATAGGG


transgene tandem integration


rp11_3'_s (P1)

GTAGGGTGTCTGGGTTGGTG


pBACe_11326_s (P2)

CGGTTACGGTTGAGTAATAAATGGATG


pBACe_11365_s (P3)

GGGGCACATTTCATTACCTCTTTCTC


Koppel et al. BMC Neuroscience 2009 10:68   doi:10.1186/1471-2202-10-68

Open Data