Table 1

PCR primers for chromatin immunoprecipitation assays

Gene

Positions†

Sense primer

Anti sense primer

bp


Rho

-200 to +64

ggggcagacaagatgagacac

ttcgtagacagagaccaaggc

264


Pde6b

-201 to +56

actgcccataactcctgtaac

tgttcctgctgctgtgcccg

257


Rbp3

-28 to +95)

cctcacatctaactcccacattg

ccttggctcctggataagag

123


Mop

-216 to -23

tgagccacccctgtggattg

ggaacctgtcagacttggcac

194


Sop

-396 to -202

cactcatcctcttcctgtttcc

ggtcagtattggtttctgtggc

195


Alb

-547 to -82

ggacacaagacttctgaaagtcctc

ttcctaccccattacaaaatcata

465


mGluR6

-139 to +67

ccagaggttggctcaggtaag

gcaggaaaagttggtgactcg

206


†Relative to the transcriptional start site (+1).

Rho (Rhodopsin), Pde6b (cGMP-dependent phosphodiesterase-beta subunit), Rbp3 (Interphotoreceptor retinoid binding protein), Mop (M-Opsin), Sop (S-Opsin), Alb (Albumin), GluR6 (metabotropic glutamate receptor subtype-6).

Mali et al. BMC Molecular Biology 2008 9:87   doi:10.1186/1471-2199-9-87

Open Data