Table 5

Preamplification primers for SSRT-PreAmp

Gene

5' sense 3' primer

5' antisense 3' primer


HPRT-CCM

GATATAATTGACACTGGCAAAAC

ACAAACATGATTCAAATCCCTGA

CD3z

CCGATTACAGAGGCACAGAG

TCGTACTCCTCTCTTCGTCC

IFNg

TTTTGGGTTCTCTTGGCTGTTA

CTCTTTTGGATGCTCTGGTCA

FoxP3

CCCAGAGCTCCTACCCACT

TGGCACTCAGCTTCTCCTTC

T-bet

GACTGGAGGTGTCGGGGAA

CCACGTCCACAAACATCCTG

GATA3

TCACAAAATGAACGGACAGAAC

TAATATTGTGAAGCTTGTAGTAGA

Granulysin

AGGAGCTGGGCCGTGACTA

CTCTAGACTGATACCTCCTCA

Perforin

TGTGGCCGGCTCACACTCA

CGTAGTTGGAGATAAGCCTGA


Sequences of primers used for SSRT-PreAmp of the investigated 8 target genes.

Noutsias et al. BMC Molecular Biology 2008 9:3   doi:10.1186/1471-2199-9-3

Open Data