Table 2

List and characteristics of primers used in real-time PCR experiments
Target Full name [mRNA NCBI accession ID] Primer sequence (5′ to 3′) Amplicon size (bp) Slope r2 Eff
β-Act Actin beta [NM_001101.3] F: AGGCCAACCGCGAGAAGATGACC 332 -3.486 0.998 1.94
R: GAAGTCCAGGGCGACGTAGCAC
GAPDH glyceraldehyde-3-phosphate dehydrogenase [NM_002046.4] F: TTCTTTTGCGTCGCCAGCCGA 96 -3.402 0.998 1.97
R: GTGACCAGGCGCCCAATACGA
18S 18S ribosomal RNA [NR_003286.2] F: GGCGCCCCCTCGATGCTCTTAG 89 -3.488 1 1.94
R: GCTCGGGCCTGCTTTGAACACTCT
B2M beta-2-microglobulin [NM_004048.2] F: TGCCTGCCGTGTGAACCATGT 97 -3.319 0.997 2.00
R: TGCGGCATCTTCAAACCTCCATGA
RP2 polymerase (RNA) II (DNA directed) polypeptide A [NM_000937.4] F: TCCCATGGGTGGAATCTCTCCTGC 162 -3.767 0.995 1.84
R: GAGTAACCTGGGCTGAAGCCGC
PPIA peptidylprolyl isomerase A (cyclophilin A) [NM_021130.3] F: ACCGCCGAGGAAAACCGTGTA 129 -3.217 0.999 2.05
R: TGCTGTCTTTGGGACCTTGTCTGC
RPL27 ribosomal protein L27 [NM_000988.3] F: TGGTAGGGCCGGGTGGTTGC 185 -3.203 0.997 2.05
R: ACTTTGCGGGGGTAGCGGTC
RPS13 ribosomal protein S13 [NM_001017.2] F: TCGGCTTTACCCTATCGACGCAG 153 -3.429 0.999 1.96
R: ACGTACTTGTGCAACACCATGTGA
YBX3 +Ψ Y box binding protein 3 [NM_003651.4/NM_001145426.1] F: CGGTTCATCGAAATCCAACT 166 -3.519 0.999 1.92
R: TAATTGTAGGGACGCCGGTA
YBX3-Ψ Y box binding protein 3 [NM_003651.4/NM_001145426.1] F: CCACCAAAGTCCTTGGCACTGTC 240 -3.452 0.998 1.95
R: TCCCTTCCACAGGAACTCCATCCG
VEGFa vascular endothelial growth factor A [NM_001025366.2] F: AGAAACCACGCTGCCGCCAC 118 -3.191 0.993 2.06
R : GTCTCGCCCTCCGGACCCAA
c-Myc v-myc myelocytomatosis viral oncogene homolog [NM_002467.4] F: TACAACACCCGAGCAAGGAC 189 -3.2 0.998 2.05
R: AGCTAACGTTGAGGGGCATC
CycD1 cyclin D1 [NM_053056.2] F: CGCCCCACCCCTCCAG 221 -3.136 0.997 2.08
R: CCGCCCAGACCCTCAGACT
PCNA proliferating cell nuclear antigen [NM_002592.2] F: GTAGTAAAGATGCCTTCTGGTG 190 -3.425 0.997 1.96
R: TCTCTATGGTAACAGCTTCCTC

Database source for sequence design is the NCBI gene browser (http://www.ncbi.nlm.nih.gov/gene webcite). PCR efficiency was calculated with standard curves (slope and r2 included) according to Rasmussen formula [28]. (F: Forward; R: Reverse). Note that bases indicated in bold text in YBX3 primers correspond to mismatches in the YBX3 pseudogene 1 sequence [NR_027011.1].

Dupasquier et al.

Dupasquier et al. BMC Molecular Biology 2014 15:9   doi:10.1186/1471-2199-15-9

Open Data