Table 2

Primers used in this study
Name Sequence Comments
attB-F GTCATTAATCGCCATTCAGGCTGCGCA To amplify 400 bp attB site in AseI of pEGFP-N1
attB-R GTCATTAATCTCGGCCTCGACTCTAG
attL-F GGCGAGAAAGGAAGGGAAG To detect the attL site, 400 bp
attL-R ATTAACCCTCACTAAAGGGA
attR-F TCAAAGTAAACGACATGGTG To detect the attR site,520 bp
attR-R CCAACCGCTGTTTGGTCTGC
IV-R1 GCTTATAGATACCGTAGACAT TAIL-PCR to identify integration site
IV-R2 TCCCGTGCTCACCGTGACC
IV-R3 ATCAACTACCGCCACCTCG
IV-F2 CGCCACCTCTGACTTGAGCG
5113-LF GTTGGGATTTGGCTCCAGCC Use with IV-R1 for determination of 5′ end of 5113 pseudo attP site
5113-RR TCTTAACACCCCATTGTTCTC Use with IV-F2 for determination of 3′ end of 5113 pseudo attP site
5156-LF GCCTTAATGAGGGCCAGAGC Use with IV-R1 for determination of 5′ end of 5156 pseudo attP site
5156-RR GTTGACCCATTTTCCTGCTCTTCG Use with IV-F2 for determination of 3′ end of 5156 pseudo attP site
1015-LF GTCCTGCCCTGACCCTTTGG Use with IV-R1 for determination of 5′ end of 1015 pseudo attP site
1015-RR GCCAACCTCCAAGTTGTTGG Use with IV-F2 for determination of 3′ end of 1015 pseudo attP site
2015-LF GCAAGGGGTT TTGAAACTGC Use with IV-R1 for determination of 5′ end of 2015 pseudo attP site
2015-RR AAAAGTGCCTCAGAACACCAC Use with IV-F2 for determination of 3′ end of 2015 pseudo attP site
5113-pF TCAAAGTAAACGACATGGTGGAGTGTAGCAGTTCCTAGGC ABI-REC cloning of 5113 pseudo attP site in pBCPB+ plasmid
5113-pR ATTAACCCTCACTAAAGGGATCTTAACACCCCATTGTTCTC
5156-pF TCAAAGTAAACGACATGGTGGACCTCTGCTGTGCCCAGAG ABI-REC cloning of 5156 pseudo attP site in pBCPB+ plasmid
5156-pR ATTAACCCTCACTAAAGGGACCAACCACTGGCTTCCCTCG
1015-pF TCAAAGTAAACGACATGGTGACCCCCACCCTGAGCTACTC ABI-REC cloning of 1015 pseudo attP site in pBCPB+ plasmid
1015-pR ATTAACCCTCACTAAAGGGAACTCCCCAGCAACCAGCTTC
2015-pF TCAAAGTAAACGACATGGTGATGAGACAAGAGGGACCAGG ABI-REC cloning of 2015 pseudo attP site in pBCPB+ plasmid
2015-pR ATTAACCCTCACTAAAGGGAAAAAGTGCCTCAGAACACCAC
Pseudo-P1R CACCATGTCGTTTACTTTGA ABI-REC cloning of pig pseudo site
BCPB-S GCTGCAAGGCGATTAAGTTGGG Sequencing primer
EGFP-QF TGAACCGCATCGAGCTGAAGGG Real-time PCR primers, 130 bp
EGFP-QR ACCTTGATGCCGTTCTTCTGCTTG
TFRC-QF GAGACAGAAACTTTCGAAGC Real-time PCR primers, 81 bp
TFRC-QR GAAGTCTGTGGTATCCAATCC

Bi et al.

Bi et al. BMC Molecular Biology 2013 14:20   doi:10.1186/1471-2199-14-20

Open Data