Table 1

Cloning of products from RNA-I processed by recombinant DICER protein

Count


......CGGGUAGCUUAUCAGACUGAUGU..............................................

23

.......GGGUAGCUUAUCAGACUGAUGU..............................................

19

......CGGGUAGCUUAUCAGACUGAUG...............................................

9

.....UCGGGUAGCUUAUCAGACUGAUGU..............................................

1

.....UCGGGUAGCUUAUCAGACUGAUG...............................................

1

.......GGGUAGCUUAUCAGACUGAUGUU.............................................

1

......CGGGUAGCUUAUCAGACUGA.................................................

1

.............................UGACUGUUGAAUCUCAUGGCAA........................

4

.............................UGACUGUUGAAUCUCAUGGCAACA......................

2

............................UUGACUGUUGAAUCUCAUGGCAAC.......................

1

....................................................ACCAGUCGAUGGGCUGUCUGAC.

2

.....................................................CCAGUCGAUGGGCUGUCUGA..

2

....................................................ACCAGUCGAUGGGCUGUCUGA..

1


GGGUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA

...((((((((((((((((.(((((.(((((.((((........))))))))).)))))))))))))))))))))

(-34.60)


Ando et al. BMC Molecular Biology 2011 12:6   doi:10.1186/1471-2199-12-6

Open Data