Table 2

PCR primers.

Species

Gene

Purpose

Forward

Reverse

Probe


Human

ALU

Real-time PCR

CGGTGGCTCACGCCTGTA

GAGTGCAGTGGCGCGATC

Human

ALU

MethyLight

GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA

ATTAACTAAACTAATCTTAAACTCCTAACCTCA

CCTACCTTAACCTCCC

Human

LINE

Real-time PCR

ACGGAATCTCGCTGATTGCT

CGTTGCCGCCTTGCA

Mouse

MCP-1

Real-time PCR

GAATGAAGGTGGCTGCTATG

AACCCAGAAACATCCAATTCTC

Human

SFRP1

Real-time PCR

CTTACCTTGGGGCTTGGAG

CTACTGGCCCGAGATGCTTA

TTTCGCGTTTTTTTGT

Human

SPARC

Real-time PCR

GGTTTCCTGTTGCCTGTCTC

GGGGGTCACACATACCTCAG

Human

SPARC

MethyLight

TTTCGCGGTTTTTTAGATTGTTC

CATACCTCAATAACAAACAAACAAACG

CAAAACGCGCTCTC

Mouse

TGF-β1

Real-time PCR

TTTGAGACTTTTCCGCTGCT

AATAGGGGCGTCTGAGGAAC


Yu et al. BMC Molecular Biology 2011 12:49   doi:10.1186/1471-2199-12-49

Open Data