Table 2

PCR primers used in this study.

mRNA

mRNA name

GenBank accession no.

Forward primer1

Reverse primer1

Amplicon Size [bp]

PCR efficiency [%]


ABL1

c-abl oncogene 1

NM_005157.3, NM_007313.2

GAGCACAGAGACACCACTGACG

GCTCATCTTCATTCAGGCCG

148

100.9

ACTB

β-actin

NM_001101.3

ATTGCCGACAGGATGCAGAA

GCTGATCCACATCTGCTGGAA

150

97.9

B2M

β-2-microglobulin

NM_004048.2

GCTCCGTGGCCTTAGCTGT

ACGTGAGTAAACCTGAATCTTTGGA

89

101.1

CD36

CD36

NM_001001548.2, NM_001001547.2, NM_000072.3, NM_001127443.1, NM_001127444.1

TCACTGCGACATGATTAATGGTACA

ACGTCGGATTCAAATACAGCATAGAT

126

99.2

EIF2B2

Eukaryotic translation initiation factor 2B2

NM_014239.2

TCCACCCCACTCATCGTCTG

TGGCAGGACTTCTTCAGGAGC

105

101.1

G6PD

Glucose-6-phosphate dehydrogenase

NM_000402.3, NM_001042351.1

CCGTCACCAAGAACATTCACG

GGACAGCCGGTCAGAGCTCT

107

98.7

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

NM_002046.3

CAACAGCGACACCCACTCCT

CACCCTGTTGCTGTAGCCAAA

115

101.7

GUSB

β-glucuronidase

NM_000181.3

AGCTCATTTGGAATTTTGCCG

GAGTGAAGATCCCCTTTTTATTCCC

81

101.8

H3F3A

H3 histone, family 3A

NM_002107.3

TGGCGCTCCGTGAAATTAGA

TGAGCAATTTCTCGCACCAGA

91

97.0

POLR2K

Polymerase (RNA) II (DNA-directed) polypeptide K

NM_005034.3

ACCCAGAAGGACGTTCAACCTC

TCTCTGCATCTGATTGGATCCC

107

98.9

PPARA

Peroxisome proliferator-activated receptor α

NM_001001928.2, NM_005036.4

AGCCCCTCCTCGGTGACTTAT

GCTTGAGTCGAATCGTTCGC

172

94.6

PPARD

Peroxisome proliferator-activated receptor δ

NM_006238.3, NM_177435.2

AGAACCGCAACAAGTGCCAG

GCATCCGACCAAAACGGA

87

99.1

PPARG

Peroxisome proliferator-activated receptor γ

NM_138712.3, NM_015869.4, NM_138711.3, NM_005037.5

TTCAGAAATGCCTTGCAGTGG

AGCTTCTCCTTCTCGGCCTG

79

100.6

PPIB

Peptidylprolyl isomerase B (cyclophilin B)

NM_000942.4

ATGGCAAGCATGTGGTGTTTG

CCCGGCTGTCTGTCTTGGT

84

96.8

PSMB2

Proteasome subunit, β type 2

NM_002794.3

ACGGCAGCAGCTAACTTCACA

TGGCCCTTCATGCTCATCA

108

101.9

PSMB6

Proteasome subunit, β type 6

NM_002798.1

GGAATCATCATCGCAGGCTG

CTGCCTTACCATCATACCCCC

81

101.6

QARS

Glutaminyl-tRNA synthetase

NM_005051.1

GAGCGTCTTGGATATTTCTCCGT

GCTTCCAGCTCACACCTTTCC

108

98.3

RPL37A

Ribosomal protein L37a

NM_000998.4

ATTGAAATCAGCCAGCACGC

AGGAACCACAGTGCCAGATCC

94

97.6

SRP14

Signal recognition particle 14 kDa

NM_003134.4

AGCACTGTGGTGAGCTCCAAG

TCAGCCCATCCATGTTAGCTCTA

82

95.1

TUBA1

α1-tubulin

NM_006009.2, NM_006082.2, NM_032704.3

GCACTACACCATTGGCAAGGA

AACCAGTTCCCCCACCAAAG

122

98.4

TXNRD1

Thioredoxin reductase 1

NM_003330.2, NM_182742.1, NM_182729.1, NM_182743.1, NM_001093771.1

CACAATTGGAATCCACCCTGTC

GCTTGCCCCAGAGCGC

73

99.2

UBE2D2

Ubiquitin-conjugating enzyme E2D 2

NM_003339.2

CCAGATGATCCTTTAGTGCCTGAG

ACATCGCATACTTCTGAGTCCATTC

100

102.5


1In each case, forward and reverse primers are located in different exons.

Maeß et al. BMC Molecular Biology 2010 11:90   doi:10.1186/1471-2199-11-90

Open Data