Table 2

Primer sequences of GAPDH

Gene

Sequence (5'-3')

Size of PCR product


GAPDH (Forward)

TCCCTGAGCTGAACGGGAAG

217

GAPDH (Reverse)

GGAGGAGTGGGTGTCGCTGT


Zainuddin et al. BMC Molecular Biology 2010 11:59   doi:10.1186/1471-2199-11-59

Open Data