Table 1

Candidate reference and differentially expressed genes with putative function and gene ID from the Dappu V1.1 draft genome annotation, primer sequences, amplicon characteristics.

Gene symbol

Gene name

(putative) Function

Gene ID

P

Primer sequences [5'→3']

L (bp)

Localization in gene

E (%)


aTub

alpha Tubulin

Cytoskeletal protein

Dappu-301837

5

GCATGTTGTCCAACACTACTGC

135

3' exon

91

CCTCAGAGAACTCTCCCTCCTC

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

Glycolytic enzyme

Dappu-302823

0

TGGGATGAGTCACTGGCATAC

136

3' exon

93

GAAAGGACGACCAACAACAAAC

Tbp

TATA binding protein

Transcription initiation

Dappu-194512

0

CTACGATGCATTCGATAACATATACC

144

3' exon

90

AGAACCAGCAATGAGTTAAACAAAG

Stx16

Syntaxin 16

Protein involved in exocytosis

Dappu-194044

0

CACATTGGTCGTCCTTAGTCTTG

148

3' exon

93

TGCTATACGTTACGCTTGTCCTTAC

Xbp1

X-box binding protein 1

Transcription factor

Dappu-314438

0

CCGATATTCGAGACTGCAATG

131

3' exon

93

AAAGATGGGTGAGCCAGAAATAC

MMP

Matrix metallo-proteinase

Degradation of extracellular proteins

Dappu-303491

0

CGAAACATGGACGCATAACTC

80

spanning penultimate 3' intron

92

GTCCCAAAGTGTGACCGAAC

CAPON

C-terminal pdz ligand of neuronal nitric oxide synthase

Location of neuronal nitric oxide synthase

Dappu-100564

0

TAACGAGTCGGGAGGAAGTG

140

3' exon

94

GCTGGACTTGAGCCAGTATCTC


Abbreviations: E: amplification efficiency; P: number of paralogs in D. pulex genome; L: length of the amplicon

Spanier et al. BMC Molecular Biology 2010 11:50   doi:10.1186/1471-2199-11-50

Open Data