Table 5

Primer sequences of eight reference genes used in the validation study.

Target Gene

Gene Accession

Number

Tm

Primer Sequence


B2M

NM_004048.2

55°C

F-5'GTGCTCGCGCTACTACTCTCTCT

R-5'TCAATGTCGGATGGATGAAA

GAPDH

NM_002046.2

55°C

F-5'ACAGTCAGCCGCATCTTCTT

R-5'GACAAGCTTCCCGTTCTCAG

ACTB

NM_001101.2

55°C

F-5'CTCTTCCAGCCTTCCTTCCT

F-5'AGCACTGTGTTGGCGTACAG

HPRT1

NM_000194.1

55°C

F-5'AAGCTTGCTGGTGAAAAGGA

R-5'AAGCAGATGGCCACAGAACT

YWHAZ

NM_001135702.1

55°C

F-5'ACTTTTGGTACATTGTGGC

R-5'CCGCCAGGAAAAACCAGT

18S

NR_003286.2

60°C

F-5'AGGAATTCCCAGTAAGTGCG

R-5'GCCTCACTAAACCATCCAA

RP II

NM_000937.3

60°C

F-5'CTTCACGGTGCTGGGCATT

R-5'GTGCGGCTGCTTCCATAA

UBC

XM_002344708.1

60°C

F-5'CCTGGTGCTCCGTCTTAGAG

R-5'TTTCCCAGCAAAGATCAACC


Mehta et al. BMC Molecular Biology 2010 11:39   doi:10.1186/1471-2199-11-39

Open Data