Open Access Highly Accessed Research article

Loss of the insulator protein CTCF during nematode evolution

Peter Heger1*, Birger Marin2 and Einhard Schierenberg1

Author Affiliations

1 Zoological Institute, University of Cologne, Kerpener Strasse 15, 50937 Köln, Germany

2 Botanical Institute, University of Cologne, Gyrhofstrasse 15, 50931 Köln, Germany

For all author emails, please log on.

BMC Molecular Biology 2009, 10:84 doi:10.1186/1471-2199-10-84


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2199/10/84


Received:20 February 2009
Accepted:27 August 2009
Published:27 August 2009

© 2009 Heger et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The zinc finger (ZF) protein CTCF (CCCTC-binding factor) is highly conserved in Drosophila and vertebrates where it has been shown to mediate chromatin insulation at a genomewide level. A mode of genetic regulation that involves insulators and insulator binding proteins to establish independent transcriptional units is currently not known in nematodes including Caenorhabditis elegans. We therefore searched in nematodes for orthologs of proteins that are involved in chromatin insulation.

Results

While orthologs for other insulator proteins were absent in all 35 analysed nematode species, we find orthologs of CTCF in a subset of nematodes. As an example for these we cloned the Trichinella spiralis CTCF-like gene and revealed a genomic structure very similar to the Drosophila counterpart. To investigate the pattern of CTCF occurrence in nematodes, we performed phylogenetic analysis with the ZF protein sets of completely sequenced nematodes. We show that three ZF proteins from three basal nematodes cluster together with known CTCF proteins whereas no zinc finger protein of C. elegans and other derived nematodes does so.

Conclusion

Our findings show that CTCF and possibly chromatin insulation are present in basal nematodes. We suggest that the insulator protein CTCF has been secondarily lost in derived nematodes like C. elegans. We propose a switch in the regulation of gene expression during nematode evolution, from the common vertebrate and insect type involving distantly acting regulatory elements and chromatin insulation to a so far poorly characterised mode present in more derived nematodes. Here, all or some of these components are missing. Instead operons, polycistronic transcriptional units common in derived nematodes, seemingly adopted their function.

Background

Chromatin insulation plays a profound role in regulating gene expression and is mediated by the binding of insulator proteins to specific DNA sequence elements. So far, in only a limited number of organisms insulator function has been demonstrated: in yeast [1-3], sea urchin [4,5], Drosophila (e. g. [6,7]), and vertebrates (e. g. [8,9]). D. melanogaster and vertebrates are the only metazoan systems where insulator binding proteins have been identified. In Drosophila, Suppressor of Hairy Wing [Su(Hw)], Boundary Element Associated Factors (BEAF-32A and BEAF-32B), Zeste-white 5 (Zw5), GAGA Binding Factor (GAF), and, most recently, CTCF (dCTCF) have been described as functional insulator proteins. In contrast, there is only one known insulator protein in vertebrates, CTCF, which is associated with all known insulators [10,11].

CTCF was initially described as a transcriptional regulator of the chicken c-myc proto-oncogene [12]. Besides its function as a transcription factor, CTCF is important for several other cellular processes, e. g. genomic imprinting, X-chromosome inactivation, control of DNA methylation state, or long-range chromatin interactions (for review see [13]). The link between CTCF and chromatin insulation was established in 1999 with the discovery that the borders of the chicken β-globin locus have insulator activity and resemble CTCF binding sites necessary for insulating the β-globin genes and maintaining their distinct regulatory programs [14,15].

Recently, a systematic computational search for conserved noncoding elements revealed a highly enriched CTCF binding motif occurring at nearly 15.000 positions within the human genome [16]. Nearby genes separated by predicted CTCF sites exhibited a markedly reduced correlation in gene expression, consistent with the hypothesis that CTCF insulator sites partition the genome into independent domains of gene expression. A similar number of potential insulator sites was found by chromatin immunoprecipitation experiments (ChIP) against CTCF and, strikingly, the CTCF binding consensus motif deduced there was virtually identical to the enriched conserved element defined in the first study [17]. In addition, it was shown that the sites of CTCF-binding sequences in the human genome are highly conserved in other vertebrates, consistent with a widespread and fundamental role of CTCF in different organisms. More evidence of CTCF function in the establishment of discrete chromosomal domains was provided by [18] who showed that interactions between genome and nuclear lamina take place abundantly with CTCF sites preferentially demarcating the identified lamina associated domain borders. These data suggest that CTCF is an essential organiser of long-range chromatin interaction and transcription across species.

In 2005, presence of a CTCF ortholog outside the vertebrates was reported for the first time [19]. This Drosophila CTCF had a binding site specificity similar to vertebrate CTCF and conveyed insulator activity to one known insulator in the Drosophila Abdominal-B locus of the Bithorax complex. ChIP-chip experiments of the whole Bithorax complex revealed that dCTCF is directly associated with almost all known or predicted insulators in this region [20]. Binding of dCTCF to the insulators of the Bithorax complex is relevant in vivo because dCTCF null mutations in the fly affect expression of Abdominal-B, cause pharate lethality and a homeotic phenotype [21]. The relevance of CTCF for normal development was also illustrated in vertebrates as its elimination in mice resulted in early embryonic lethality [22].

These reports from vertebrates and flies highlight the importance of chromatin insulation and insulator binding proteins on a global genomic scale in both systems (for recent reviews, see [13,23]). Moreover, the work about dCTCF showed that a key player of chromatin insulation is conserved from fly to man. We reasoned therefore that chromatin insulation might also be a relevant mechanism of regulating gene expression in nematodes and conducted a systematic computational survey of all available nematode genomes and EST data sets to detect orthologs of the presently known insulator binding proteins.

In the following we will frequently refer to «basal» and «derived» nematodes. In a recent publication, the phylum Nematoda has been divided into 12 clades [24]. According to this classification we define members of clades 1 and 2 as «basal» nematodes, while members of clades 3 – 12 including C. elegans (clade 9) are designated «derived». This view of the Nematoda being divided into two major groups corresponds to their partition into the classes Enoplea (basal, paraphyletic) and Chromadorea (derived, monophyletic; see Discussion for further arguments supporting this view) [25,26].

Results

Known insulator binding proteins are not found in nematodes except CTCF

We searched whole genome sequence databases of seven nematode species for orthologs of the known insulator proteins Su(Hw), BEAF-32, GAGA factor, Zw5, and CTCF.

With dCTCF as query, a high scoring predicted open reading frame (ORF; e-113) was identified in the genome assembly of the basal nematode Trichinella spiralis, but not in the genomes of other, more derived nematodes (Table 1). Reciprocal BLAST searches of this ORF in the NCBI database confirmed a high similarity to CTCF proteins of insects and vertebrates. The same approach, when conducted with the reported hits from other nematode genomes, resulted in non-CTCF zinc finger proteins (data not shown).

Table 1. BLAST results for insulator protein searches in nematode genomes

When we searched for Su(Hw) or Zw5 orthologs, relatively high BLAST scores were generated in some nematode genomes (Table 1). Reciprocal BLAST analysis at the NCBI website however showed that, in all cases, these could be attributed to a number of adjacent C2H2 zinc finger domains and never traced back to an insulator protein query.

The insulator proteins BEAF-32A and B, which do not contain ZFs, and GAGA factor, having a single ZF, did not produce significant hits in our nematode data set, suggesting the general absence of a related protein in nematodes (Table 1).

Searches for Su(Hw), Zw5, and CTCF orthologs in Brugia malayi resulted in considerably higher scores compared to other nematode genomes (Table 1). But again, reciprocal best BLAST could not unveil a link to known insulator proteins (data not shown). Remarkably, however, these scores are produced from a family of ZF proteins consisting of at least 15 extraordinary similar members with multiple adjacent ZFs whose most similar sequences in humans are the KRAB containing ZF proteins 235 and 93 (Q14590 and NP_004225). A similar family of nearly identical ZF proteins is absent in other nematode genomes (PH, unpublished data).

In contrast to the Caenorhabditis species, an annotated set of the protein coding regions is not yet available for the Ascaris suum and Pristionchus pacificus genomes, restricting our data set to the possible ORFs derived from the preliminary sequence assembly. Therefore, BLAST analysis can reveal only single similar ORFs and not whole annotated proteins, explaining the lower average scores in these organisms (Table 1).

We noticed that BLAST analysis with the ZF proteins Su(Hw), Zw5, and CTCF generated the following partially overlapping gene matches in the C. elegans genome: F25D7.3; Y55F3AM.14; Y38H8A.5; C55B7.12; F45B8.4; R12E2.1; R11E3.6; T27E9.4 (for information see [27]). For three of these proteins, the function is known, e. g. as a transcription factor in specific cells [28-30]. For the remaining proteins no functional data or mutant alleles exist and their RNAi-mediated knockdown did not result in observable phenotypes (except in F25D7.3) [27]. Therefore, the available information about the above mentioned C. elegans proteins gives no indication that they might act as insulator proteins [27]. The same conclusions also apply to the C. briggsae and C. remanei genomes.

To extend our data set, we conducted BLAST searches with the same five insulator protein sequences in all available nematode ESTs (http://www.nematode.net webcite[31]). Consistent with our previous results (Table 1), we could not obtain candidates for any of the known insulator proteins after reciprocal BLAST tests (data not shown) except for CTCF. We identified CTCF orthologs in two out of three other basal nematodes, in Xiphinema index (clone XI00686, 5.9e-73) and Trichuris muris (clone TM01708, 1.6e-62), but not in the ESTs of 32 derived nematode species.

Taken together, our results suggest that the whole nematode phylum apparently does not possess known insulator proteins, except orthologs of the genome organiser and insulator protein CTCF which seems to be restricted to basal nematodes.

Cloning and characterisation of CTCF from the basal nematode T. spiralis

To confirm our computational identification of putative CTCF orthologs in basal nematodes, we cloned the mRNA of the T. spiralis CTCF ortholog (tsCTCF). Comparison with the unpublished T. spiralis genome sequence assembly (accession number ABIR01000000) revealed that tsCTCF lies on a 6.5 kb genomic locus. The primary transcript contains four exons, with the first and last being untranslated, and three introns, with a large second intron (1.7 kb). The resulting 4.6 kb mRNA has a 414 bp 5'UTR and a 1328 bp 3'UTR, both harboring a small intron of about 100 bp. The deduced protein coding region (948 AA) is a fusion of two exons, a small first one and a large second exon carrying the entire ZF region (Figure 1B).

thumbnailFigure 1. Conserved genomic organisation of invertebrate CTCFs. A, B, C: Genomic CTCF loci of vertebrates, Drosophila [19] and Trichinella, drawn to scale. Transcription start (arrow), transcription end (polyA), translation start (ATG) and stop (TAA, TAG, TGA), exons (box), introns (line), protein coding region (shaded), and zinc finger region (light green) are indicated. To illustrate the structure of vertebrate CTCFs, human CTCF is depicted (accession number NT_010498). D: Domain organisation of tsCTCF. Ⓟ: Predicted Tyrosine phosphorylation site, polyQ: poly-Glutamine tract, S-rich: Serine-rich region, N-rich: Asparagine-rich region, RCC1: RCC1 chromatin binding motif, ZF: Zinc finger region. Predicted N-glycosylation, N-myristoylation and most phosphorylation sites are not shown.

A comparison of the genomic structure reveals remarkable similarities between Trichinella and Drosophila CTCF, the most closely related published CTCF ortholog (Figure 1A, B). Both invertebrate CTCFs contain only four exons while ten small exons are scattered over a large genomic locus in all vertebrate CTCFs (Figure 1C). The entire ZF region of the invertebrate CTCFs is located on a large exon comprising ≥80% of the coding region while it is composed of seven short exons in vertebrates [32]. The 5'UTR, interrupted by an intron, is leading in frame to the translation start in both, Trichinella and Drosophila CTCF. However, unlike dCTCF the Trichinella gene carries a larger 3'UTR (1328 bp versus 320 bp) that is also present in vertebrate CTCFs (1413 bp for the chicken CTCF 3'UTR [33]).

The central region of the protein contains ten C2H2 ZFs conserved in all reported CTCF sequences [19,32]. Within vertebrates, the eleventh ZF is of the C2HC-type. In Drosophila however, ZF11 is a C2H2-type finger and displays only weak conservation of the critical DNA binding residues as well as a small insertion (Figure 2). In tsCTCF, ZF11 is missing entirely, and neither 3'Race PCR nor the genomic sequence at this locus gave indications for its presence. These observations suggest that conservation of ZF11 is not a strict requirement for functional CTCF proteins.

Figure 2 depicts an alignment of the ZF region of human, Trichinella, and Drosophila CTCF. Most of the crucial DNA recognition residues at positions -1, 2, 3, and 6 are identical between at least two of the three species. Variations in position 6 for ZF6 and ZF9 generate a change from alanine or serine to methionine, which does not alter the DNA recognition code of the finger [19,34]. The identity within the ZF region between the human and Trichinella proteins is 52%, exceeding the rate of 44% between Drosophila and vertebrates (Table 2). Flies, however, belong to a highly derived insect order with rapid evolution [35,36]. We therefore extended our analysis to CTCF sequences from more «basal» insects, Apis mellifera and Tribolium castaneum. The CTCFs from both, basal nematodes and basal insects, are more similar to the human counterpart and to each other than Drosophila CTCF (Table 2). The lower similarity of Drosophila CTCF is therefore probably due to the rapid evolution of the fly insect order.

thumbnailFigure 2. Conserved zinc finger region of tsCTCF. Multiple sequence alignment of the ZF domains of T. spiralis, human, and D. melanogaster CTCF. Similar and identical residues (grey), zinc coordinating residues (red, blue), and identical residues for DNA recognition (yellow) are indicated. ZF11 is missing in T. spiralis and is less conserved between D. melanogaster and man than ZF1 – 10.

Table 2. Similarity of CTCF zinc finger regions

CTCFs contain conserved motifs in the N- and C-terminal domains which are important mainly for protein-protein interaction [37]. Prominent candidates for such motifs could not be found in the Trichinella N- and C-terminal domains. In particular, an AT hook motif described for Drosophila and vertebrate CTCFs is absent in Trichinella. Nevertheless, scanning the coding region in the PRINTS [38] and PROSITE databases [39] generated several matches. Consistent with the presumed DNA binding function of the protein, a putative RCC1 chromatin binding motif was detected near the C-terminus (AA 869 – 886) that is not present in other known CTCFs. Commonly found post-translational modifications like N-glycosylation (6 instances), N-myristoylation (14 instances), and phos-phorylation (22 instances, including cAMP-dependent kinase, Casein kinase II, Protein kinase C, and Tyrosine kinase sites) were also predicted for tsCTCF, the latter being consistent with the presence of functional phosphorylation sites in vertebrate CTCF [40]. In addition, pronounced Glutamine-rich regions (AA 148 – 168 and 252 – 338), a Serine-rich region (AA 698 – 723), and an Asparagine-rich region (AA 736 – 766) are present in Trichinella, but not in other CTCFs (Figure 1D).

Despite minor differences, the similar genomic organisation of Trichinella CTCF and Drosophila CTCF as well as the remarkable conservation of the ZF domain and DNA binding residues point to a conserved function of this protein in the basal nematode Trichinella spiralis. This assumption is further supported by our work in progress that demonstrates a specific binding of Trichinella CTCF to known Drosophila CTCF target sites in electric mobility shift experiments, indicating that the binding preferences of the two proteins are very similar (M. Bartkuhn and P. Heger, unpublished data).

Loss of CTCF during nematode evolution

In our initial survey we identified several putative CTCF orthologs in basal nematodes while in derived nematodes like C. elegans or B. malayi a protein with a high similarity to CTCF could not be detected. This raises the possibility that originally CTCF was present in nematodes, but was lost during nematode evolution.

To test this hypothesis we performed a phylogenetic analysis with a C2H2 ZF protein alignment that contained (i) three putative CTCF orthologs from basal nematodes (Trichuris muris, Xiphinema index, and Trichinella spiralis), (ii) 17 annotated CTCF proteins from insects and vertebrates (including «Boris» sequences, a vertebrate CTCF paralog), and (iii) 89 selected C2H2 ZF proteins (see Methods) derived from the Trichinella spiralis and Caenorhabditis elegans genome sequences (Figure 3).

thumbnailFigure 3. Presence of CTCF in basal nematodes. Phylogenetic analysis of ZF proteins from nematodes, insects, and vertebrates. The tree topology resulted from protein maximum likelihood, using the model WAG+I+G. To test the robustness of the branching pattern, three bootstrap analyses were performed with protein maximum likelihood (WAG+I+G), neighbor joining, and maximum parsimony methods. Bootstrap support values >50% are shown. Bayesian posterior probabilities, resulting from a Bayesian analysis (model: WAG+I+G), served as additional measure for the confidence of branches. Posterior probabilities >0.94 were considered as significant, lower values were ignored. Ts000x: sequence from T. spiralis, CEx: sequence from C. elegans. All putative as well as annotated CTCF and Boris orthologs form a single, well-supported clade. Note the paralogous clusters of vertebrate CTCF and vertebrate Boris [32] within this clade. No ZF protein of the derived nematode C. elegans clusters to the known CTCFs, whereas a single ZF protein of T. spiralis and CTCFs of two other basal nematodes do so. Several significantly supported clades of non-CTCF zinc finger proteins contain orthologs of both nematode genomes analysed here (Ts/CE), indicating an early diversification of ZF proteins.

Irrespective of the method of tree reconstruction, our phylogenetic analysis recovered all known and putative CTCF orthologs as a well-supported gene family, the CTCF/Boris-clade (Figure 3). A single sequence of the basal nematode T. spiralis clustered to the CTCF/Boris-clade, whereas all remaining ZF proteins of the Trichinella genome formed many independent branches/gene families, separate from the CTCFs. Putative CTCF sequences from two other basal nematodes, Trichuris muris and Xiphinema index, were also resolved as members of the CTCF/Boris-clade. The phylogenetic position derived for the three nematode CTCFs is nearest to insect CTCFs, emphasising the close genomic similarity observed between Trichinella and Drosophila CTCF. These data confirm that our isolated Trichinella protein is indeed a member of a unique group of CTCF proteins in invertebrates.

In contrast, ZF proteins from the derived nematode and standard model system Caenorhabditis elegans behave differently. Here, all ZF proteins are clearly apart from the CTCF/Boris-clade, indicating that a CTCF ortholog is not present in C. elegans (Figure 3). We wanted to confirm these findings with corresponding ZF protein data sets from two closely related Caenorhabditis species, C. briggsae and C. remanei, and, in both cases, no ZF protein clustered to the CTCF/Boris-clade (data not shown).

When we included in our analysis a ZF set derived from the Drosophila melanogaster genome, only the single known CTCF ortholog of this species joined the CTCF/Boris-clade as in Figure 3 (data not shown).

Non-CTCF ZF proteins of the nematodes Trichinella and Caenorhabditis displayed high sequence diversity, and thus, our phylogenetic analysis largely failed to resolve the ancestral diversification of non-CTCF ZF proteins. Nevertheless, it recovered many significantly supported terminal clades (gene families) with two to several members, respectively (Figure 3). Most non-CTCF gene families are present in both, Trichinella and Caenorhabditis («Ts/CE» in Figure 3), whereas some others are confined to only one genome («Ts» or «CE» in Figure 3). These results suggest an early diversification of ZF protein families, which significantly predated the split between basal and derived nematode lineages.

Derived (e. g. Caenorhabditis) and basal nematode clades (e. g. Trichinella) are separated by about 700 million years of evolution [41,42]. To more precisely determine when CTCF was lost during nematode evolution, we included ZF sets from nematodes positioned between Trichinella and Caenorhabditis. However, we did not find CTCF-like proteins in B. malayi and A. suum (clade 8; data not shown), which are separated from C. elegans by an estimated 350 million years [43].

Inclusion of additional CTCF-like proteins from various invertebrates confirmed the position of the nematode CTCFs within the CTCF/Boris-clade, close to insect CTCFs (data not shown).

Taken together, our phylogenetic results indicate that a CTCF ortholog is present in nematodes, but only in their most basal clades.

Discussion

The fundamental role of chromatin insulation in the regulation of gene expression is increasingly being recognised in vertebrates and fly [16,20,44,45]. However, whether the underlying mechanisms and proteins are conserved throughout the animal kingdom is not known. Therefore, we conducted a first systematic approach to detect orthologs of known insulator proteins in a phylum more primitive than vertebrates and insects, in nematodes. While we could not find orthologs of other known insulator proteins, we detected orthologs of CTCF in basal, but not in derived nematodes.

As two of these basal nematodes, Trichinella spiralis and Trichuris muris, are vertebrate parasites, a simple explanation for the presence of CTCF could be horizontal gene transfer (HGT) from host to parasite.

However, our phylogenetic analysis clearly rejects this possibility (Figure 3). The nematode CTCFs do not cluster to the vertebrate CTCF proteins as one would expect for a HGT scenario. Instead, they are positioned at the root of the fly CTCF cluster. Implementation of additional CTCF-like sequences from other arthropods reinforces this finding (data not shown). Furthermore, we show that Xiphinema index, a basal plant parasitic nematode, contains CTCF. But BLAST searches indicated that a CTCF-like protein is not present in available plant genome sequences including Arabidopsis thaliana and grapevine (Vitis vinifera), a common host of Xiphinema index (not shown).

Therefore, we assume that CTCF was originally present in nematodes. Our finding of a CTCF ortholog only in basal nematodes allows several possible scenarios for the evolution of gene expression in the phylum Nematoda. One possibility is that the original function of CTCF is not related to chromatin insulation, but that insulation properties appeared later in evolution. As both, fly and vertebrate CTCF, are insulator proteins, this event then must have happened independently twice or CTCF must have lost insulator activity in nematodes. To ultimately answer this question functional data for nematode CTCFs are required. However, our work in progress argues for a functional conservation of CTCF in nematodes as the DNA binding properties of Trichinella CTCF are very similar to Drosophila CTCF (M. Bartkuhn and P. Heger, unpublished data).

In a second scenario the identified protein is a true CTCF ortholog with insulator and genome organiser activity like the vertebrate and Drosophila counterparts. If CTCF performs these essential functions in basal nematodes, how can we explain its loss in derived nematodes like C. elegans? It is conceivable that during nematode evolution CTCF was not lost, but has been altered to an extent that prevents its recognition, especially as C. elegans and other members of the nematode crown clades 8 – 12 are fast evolving organisms [24]. As the great majority of the analysed nematode genome and EST data belongs to fast evolving species, we cannot rule out this scenario. Nevertheless, explaining the absence of CTCF with a single event like a gene loss or chromosomal deletion early in nematode evolution appears more likely than independent evolutionary loss of CTCF in so many derived nematodes.

There are CTCF-dependent functions beyond chromatin insulation which are as much as important for the viability of an organism, e. g. X-chromosome inactivation, DNA methylation, or genomic imprinting. However, several arguments support the conclusion that the loss of a central player in these functions is not deleterious for C. elegans. Instead of random X-chromosome inactivation involving CTCF, like in mammals, C. elegans uses an alternative dosage compensation mechanism to repress X-linked genes which is studied in detail (for review see [46]). DNA methylation and genomic imprinting are unknown in C. elegans and other derived nematodes [47-50]. A transcription factor activity of CTCF could have been passed on to other proteins. Therefore, also these additional functions of CTCF are compatible with the absence of CTCF in derived nematodes.

If CTCF and therefore CTCF-mediated chromatin insulation are absent in those nematodes, could other proteins have acquired insulator function? Presently, no data are available to support or reject this hypothesis as chromatin insulation in C. elegans or other nematodes is unknown, so far. However, it has been suggested that generally gene expression in C. elegans is controlled by regulatory elements located immediately upstream of the transcription unit [51-53]. This seems to be different to Drosophila and vertebrates where long-range interactions with distant regulatory elements over more than 10 kb have been reported [54,55].

Thus, our finding of the insulator protein CTCF in basal nematodes and the available data from C. elegans open the possibility that chromatin insulation is absent in derived, but present in basal nematodes. This would be in line with several other reports that underscore substantial differences between basal nematodes and the derived model organism C. elegans. Here, four examples are given. (i) Embryogenesis of C. elegans and other derived nematodes is characterised by a unique type of gastrulation not found elsewhere in the animal kingdom while in the basal nematode Tobrilus diversipapillatus (clade 1) gastrulation resembles the «classical» pattern found all over the animal kingdom [56]. (ii) Hedgehog and Smoothened, parts of the Hedgehog signaling pathway, are not present in C. elegans and other derived nematodes [57], but recent studies identify a bonafide hedgehog gene in the basal nematodes Trichinella spiralis and Xiphinema index [58]. (iii) C. elegans contains a greatly reduced Hox gene complement [59] while in the basal nematode T. spiralis several additional Hox genes were identified, suggesting Hox gene loss during nematode evolution [60]. (iv) Embryogenesis of Romanomermis culicivorax, like Trichinella a representative of the basal nematode clade 2, has revealed several fundamental differences to C. elegans, for example with respect to cell division patterns and tissue formation [61,62].

Looking at these prominent differences, it appears not unlikely that a fundamental difference in the regulation of gene expression exists between basal and derived nematodes. In support of this view an additional argument can be made that directly points toward such a difference in genome organisation.

C. elegans has operons, clusters of closely spaced genes under the control of a single regulatory signal. A genomewide survey revealed more than 1.000 operons in the C. elegans genome comprising about 15% of all genes [63]. Therefore, operons have to be considered a major mode of transcriptional regulation. Although structurally different, operons are functionally similar to chromatin domains demarcated by insulator proteins as both ensure coordinated expression of enclosed genes, independently from other transcriptional units.

Operons have been shown to exist not only in C. elegans [64], but also in several distantly related nematodes [65-70]. However, these species all belong to the more derived nematode clades 8 – 12 (Figure 4B). Whether basal nematodes like T. spiralis also have their genome arranged in operons, remains to be determined. However, analysis of spliced leader trans-splicing gave no evidence that operons exist in T. spiralis [71].

thumbnailFigure 4. Phylogeny and operon structure in nematodes. A: Phylogenetic tree of the phylum Nematoda after [24]. Species mentioned in this study are indicated and mapped to their respective clade. A split between basal (Enoplea) and derived (Chromadorea) nematodes is well supported (see [25,26] and Discussion) and highlighted by color. B, C: Proposed model for a reorganisation of gene expression during nematode evolution. The presence of operons (references in parentheses) and CTCF (this study) is mapped onto the nematode phylogeny. Their mutually exclusive correlation suggests a switch during nematode evolution from transcriptional units defined by CTCF to those defined by operons (see discussion for details). With increasing formation of operons, CTCF and distant regulatory elements became obsolete. *: our data from BLAST and HMMer searches in the corresponding genome sequence. n. d.: no data. P1, P2: promoter. R1, R2: regulatory element (e. g. enhancer, silencer). A, B, C, X, Y: genes.

Based on our findings and supported by other major differences between basal and derived nematodes, we propose the following model (Figure 4): In ancestral nematodes, genome organisation and transcriptional regulation were similar to the situation in Drosophila and operons were not present like in the great majority of eukaryotes. To ascertain coordinated gene expression, CTCF-mediated chromatin insulation was used. Trans-splicing already existed in these ancient nematodes [71,72]. Therefore, the availability of a trans-splicing machinery allowed formation of operons by providing a mechanism to express their downstream genes. As operon gains outbalance operon losses [73], they eventually became a major mode of transcriptional organisation in nematodes, superseding chromatin insulation. With decreasing selection pressure, CTCF, the mediator of chromatin insulation, finally got lost. As all analysed representatives of clades 8 – 12 have operons (Figure 4B), but presumably not Trichinella, a clade 2 nematode, we place that event to the split between basal (Enoplea) and derived (Chromadorea) nematodes (Figure 4C).

Conclusion

Chromatin insulation is a fundamental feature of transcriptional regulation in eukaryotic genomes. Despite its importance, it is not known so far, whether chromatin insulation also exists in nematodes. By identifying CTCF, a mediator of chromatin insulation in vertebrates and Drosophila, our study reports for the first time that chromatin insulation might also be used for gene regulation in nematodes. We show that CTCF is restricted to the most basal nematode clades. From the absence of CTCF in derived nematodes we conclude that alternative gene regulation mechanisms developed early in nematode history allowing the loss of CTCF and possibly CTCF-mediated chromatin insulation. Attractive candidates for such a mechanism are operons, multicistronic transcription units that appear to be present in all derived nematodes. The striking correlation between presence of operons and absence of CTCF in nematodes suggests that operons replaced traditional transcription units based on chromatin insulation and CTCF.

Methods

Sequence database construction

For searching insulator proteins in C. elegans, Wormpep version 165 was downloaded from http://www.wormbase.org webcite[27]. For analysis of the B. malayi and P. pacificus genomes, the respective published whole genome sequence assemblies [69,74] were downloaded and translated into the six ORFs using Emboss [75] omitting very short ORFs of less than 28 amino acids, the approximate size of a ZF. The same procedure was applied to the C. elegans genomic sequence, to exclude the possibility of a protein missing in the annotated Wormpep data set, to the unpublished T. spiralis whole genome assembly version 1.0, and to the unpublished A. suum whole genome assembly. For control purposes, the genomes of C. briggsae [67] and C. remanei (unpublished) and the proteome set of the fly Drosophila melanogaster (downloaded from NCBI) were included.

To detect possible CTCF orthologs, the sequence sets were scanned directly with multiple CTCF tailored HMM profiles (see below). In addition, standard BLASTP searches were conducted with known insulator proteins as queries after constructing BLAST databases from the ORF sequence sets using the BLAST suite [76]. Based on these results, we included at least the best scoring 50% of the C2H2 ZF repertoire of a genome in our data set.

Generation of HMM profiles

A recent publication suggested that only four of CTCF's 11 ZFs are essential for strong binding [77]. Therefore we considered ZFs 4 – 7 an adequate marker for this protein and constructed an HMM profile of this region with sequences from eight organisms as input (five arthropods, two nematodes, one mammal). The profile was used to scan the available nematode genomes for matching ZF proteins. In addition, a second profile representing a single ZF motif was constructed from CTCF ZFs 4 – 8 of the same organisms. The hits obtained with both profiles were included into the data set for phylogenetic analyses. As a threshold, a HMMer score of ≤1 was defined to include virtually all multiple C2H2 ZF proteins of the respective organsim. For HMM profile generation and genomic scans the HMMER software was employed (http://hmmer.janelia.org webcite, [78]).

Multiple sequence alignment

BLAST and HMMer hits were combined into a non-redundant set of ZF sequences for each organism. Initial tests showed that a meaningful alignment was not possible using the raw data set due to the heterogeneity of the included proteins. We therefore restricted the data set to the ZF regions. If a protein had two or more contiguous ZF domains separated from each other, only the domain with the higher BLASTP and HMMer score was retained. Sequences with less than three ZFs were excluded from analysis. Proteins with more than 11 ZFs were trimmed to retain the 10 – 12 most similar ZFs. Although the known CTCFs have 11 ZFs, proteins with three to thirteen ZFs were ultimately allowed in the analysis. Multiple sequence alignment of the resulting data was performed using the Muscle program [79]. Alignments were viewed and edited using SeaView and TEXshade [80,81].

Phylogenetic Analyses

Our phylogenetic data sets contained sequences representing virtually all multiple C2H2 ZF proteins of the respective nematodes. As a positive control, eight vertebrate CTCF and six Boris (Brother of Regulator of Imprinted Sites, a CTCF paralog in vertebrates) sequences were included that formed distinct clusters in a previous study [32]. In addition, three published CTCF sequences from insects were incorporated [19,82]. An outgroup was not defined.

Phylogenetic trees resulting from the alignments were computed using four different methods of tree reconstruction: maximum likelihood, neighbor joining, maximum parsimony, and a Bayesian analysis. At first, the optimal model of sequence evolution was determined by ProtTest version 1.4 [83] according to the Akaike Information Criterion. The resulting optimal model (WAG+I+G) was used for maximum likelihood (with 100 bootstrap replicates) as well as Bayesian analyses with the programs PhyML version 3.0 [84] and MrBayes version 3.1.2 [85]. For Bayesian analyses, two MCMC chains with 500.000 generations were performed, and the first 100.000 generations discarded as «burnin». To determine Bayesian posterior probabilities, a 90% majority-rule consensus of the remaining 400.000 generations was calculated. Neighbor joining and maximum parsimony bootstrap analyses (each with 100 bootstrap replicates) were performed with the program PAUP version 4.0b10 [86]. The likelihood tree was initially visualized with TreeViewPPC version 1.6.6 [87], and then graphically edited with Adobe Illustrator software.

Cloning of tsCTCF

A BLAST database containing the ORFs of the unpublished Trichinella genome assembly was constructed. Herein, BLASTP searches with known CTCF queries revealed a remarkably similar ORF in Contig10.39 (e-89 for homo/mouse, e-113 for Drosophila). To clone this putative CTCF, RNA from adult T. spiralis (kindly provided by David Guiliano, Imperial College, London, UK) was used for cDNA synthesis followed by a modified Smart Race PCR protocol (Clontech Laboratories, Inc.). 3' Race PCR with a gene specific primer (ccgaagggtaactgcgagtcgatgg) resulted in a 3.1 kb fragment. To clone the 5' end, PCRs were performed with a common reverse primer and a set of forward primers situated upstream of the cloned 3' fragment in Trichinella Contig10.39 and spaced 200 – 250 bp apart from each other. The largest amplified fragment was sequenced, and this information was used to obtain the full length cDNA of tsCTCF via PCR. With primers (ataagatctatgcagcatgacacggccac) and (atactcgagacaaggaccggaccaaccgac) the entire coding sequence of tsCTCF was amplified from cDNA, resequenced and verified to be correct. Using sequence information from the unpublished T. spiralis genome we cloned and resequenced also the genomic DNA corresponding to our tsCTCF mRNA and found 100% agreement with the unpublished genome sequence. Amplification products were cloned into pJet1 vector (Fermentas). For plasmid preparation, XL1-Blue bacteria (Stratagene) were grown at room temperature (25°C) to prevent plasmid loss. For sequence annotation, the Artemis program was employed [88]. Sequence assembly was performed with the Phred/Phrap/Consed package [89,90]. Primers were designed using the Primer3 program [91]. The sequences of the Trichinella CTCF genomic locus and the corresponding mRNA were deposited in the EMBL Nucleotide Sequence Database (accession numbers FM991920 and FM991921).

Authors' contributions

PH conceived the study, cloned the gene, generated the sequence databases and sets for phylogenetic analyses and wrote the manuscript except phylogeny. BM carried out and described the phylogenetic analyses. ES participated in design and coordination of the study and critically revised the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Thanks to the Bioinformaticians and Linux community for excellent open source software. Eva Heger for discussion. The Genome Sequencing Center at Washington University School of Medicine in St. Louis for the T. spiralis, A. suum, and C. remanei genome sequence data. This research was supported in part by a grant from the Deutsche Forschungsgemeinschaft to ES (SFB 680).

References

  1. Fourel G, Boscheron C, Revardel E, Lebrun E, Hu Y, Simmen K, Muller K, Li R, Mermod N, Gilson E: An activation-independent role of transcription factors in insulator function.

    EMBO Rep 2001, 2(2):124-32. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  2. Defossez P, Gilson E: The vertebrate protein CTCF functions as an insulator in Saccharomyces cere-visiae.

    Nucleic Acids Res 2002, 30(23):5136-41. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  3. Ishii K, Arib G, Lin C, Van Houwe G, Laemmli U: Chromatin boundaries in budding yeast: the nuclear pore connection.

    Cell 2002, 109(5):551-62. PubMed Abstract | Publisher Full Text OpenURL

  4. Palla F, Melfi R, Anello L, Di Bernardo M, Spinelli G: Enhancer blocking activity located near the 3' end of the sea urchin early H2A histone gene.

    Proc Natl Acad Sci USA 1997, 94(6):2272-7. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  5. Hino S, Akasaka K, Matsuoka M: Sea urchin arylsulfatase insulator exerts its anti-silencing effect without interacting with the nuclear matrix.

    J Mol Biol 2006, 357:18-27. PubMed Abstract | Publisher Full Text OpenURL

  6. Geyer P, Corces V: DNA position-specific repression of transcription by a Drosophila zinc finger protein.

    Genes Dev 1992, 6(10):1865-73. PubMed Abstract | Publisher Full Text OpenURL

  7. Kellum R, Schedl P: A position-effect assay for boundaries of higher order chromosomal domains.

    Cell 1991, 64(5):941-50. PubMed Abstract | Publisher Full Text OpenURL

  8. Chung J, Whiteley M, Felsenfeld G: A 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila.

    Cell 1993, 74(3):505-14. PubMed Abstract | Publisher Full Text OpenURL

  9. Bell A, Felsenfeld G: Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene.

    Nature 2000, 405(6785):482-5. PubMed Abstract | Publisher Full Text OpenURL

  10. Valenzuela L, Kamakaka R: Chromatin insulators.

    Annu Rev Genet 2006, 40:107-38. PubMed Abstract | Publisher Full Text OpenURL

  11. Wallace JA, Felsenfeld G: We gather together: insulators and genome organization.

    Curr Opin Genet Dev 2007, 17(5):400-7. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  12. Lobanenkov V, Nicolas R, Adler V, Paterson H, Klenova E, Polotskaja A, Goodwin G: A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5'-anking sequence of the chicken c-myc gene.

    Oncogene 1990, 5(12):1743-53. PubMed Abstract OpenURL

  13. Filippova GN: Genetics and epigenetics of the multifunctional protein CTCF.

    Curr Top Dev Biol 2008, 80:337-60. PubMed Abstract | Publisher Full Text OpenURL

  14. Bell A, West A, Felsenfeld G: The protein CTCF is required for the enhancer blocking activity of vertebrate insulators.

    Cell 1999, 98(3):387-96. PubMed Abstract | Publisher Full Text OpenURL

  15. Saitoh N, Bell A, Recillas-Targa F, West A, Simpson M, Pikaart M, Felsenfeld G: Structural and functional conservation at the boundaries of the chicken beta-globin domain.

    EMBO J 2000, 19(10):2315-22. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Xie X, Mikkelsen T, Gnirke A, Lindblad-Toh K, Kellis M, Lander E: Systematic discovery of regulatory motifs in conserved regions of the human genome, including thousands of CTCF insulator sites.

    Proc Natl Acad Sci USA 2007, 104(17):7145-50. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Kim T, Abdullaev Z, Smith A, Ching K, Loukinov D, Green R, Zhang M, Lobanenkov V, Ren B: Analysis of the Vertebrate Insulator Protein CTCF-Binding Sites in the Human Genome.

    Cell 2007, 128(6):1231-45. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  18. Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Talhout W, Eussen BH, de Klein A, Wessels L, de Laat W, van Steensel B: Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions.

    Nature 2008, 453(7197):948-51. PubMed Abstract | Publisher Full Text OpenURL

  19. Moon H, Filippova G, Loukinov D, Pugacheva E, Chen Q, Smith S, Munhall A, Grewe B, Bartkuhn M, Arnold R, Burke L, Renkawitz-Pohl R, Ohlsson R, Zhou J, Renkawitz R, Lobanenkov V: CTCF is conserved from Drosophila to humans and confers enhancer blocking of the Fab-8 insulator.

    EMBO Rep 2005, 6(2):165-70. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  20. Holohan EE, Kwong C, Adryan B, Bartkuhn M, Herold M, Renkawitz R, Russell S, White R: CTCF genomic binding sites in Drosophila and the organisation of the bithorax complex.

    PLoS Genet 2007, 3(7):e112. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  21. Mohan M, Bartkuhn M, Herold M, Philippen A, Heinl N, Bardenhagen I, Leers J, White RA, Renkawitz-Pohl R, Saumweber H, Renkawitz R: The Drosophila insulator proteins CTCF and CP190 link enhancer blocking to body patterning.

    EMBO J 2007, 26(19):4203-14. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  22. Heath H, de Almeida CR, Sleutels F, Dingjan G, Nobelen S, Jonkers I, Ling KW, Gribnau J, Renkawitz R, Grosveld F, Hendriks RW, Galjart N: CTCF regulates cell cycle progression of alphabeta T cells in the thymus.

    EMBO J 2008, 27(21):2839-50. PubMed Abstract | Publisher Full Text OpenURL

  23. Bushey AM, Dorman ER, Corces VG: Chromatin insulators: regulatory mechanisms and epigenetic inheritance.

    Mol Cell 2008, 32:1-9. PubMed Abstract | Publisher Full Text OpenURL

  24. Holterman M, Wurff A, Elsen S, van Megen H, Bongers T, Holovachov O, Bakker J, Helder J: Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown Clades.

    Mol Biol Evol 2006, 23(9):1792-800. PubMed Abstract | Publisher Full Text OpenURL

  25. Aleshin V, Kedrova O, Milyutina I, Vladychenskaya N, Petrov N: Relationships among nematodes based on the analysis of 18S rRNA gene sequences: molecular evidence for monophyly of chromadorian and secernentian nematodes.

    Russian Journal of Nematology 1998, 6(2):175-184. OpenURL

  26. De Ley P, Blaxter M: Systematic Position and Phylogeny. In The Biology of Nematodes. Edited by Lee DL. London: Taylor & Francis; 2002:1-30. OpenURL

  27. Bieri T, Blasiar D, Ozersky P, Antoshechkin I, Bastiani C, Canaran P, Chan J, Chen N, Chen WJ, Davis P, Fiedler TJ, Girard L, Han M, Harris TW, Kishore R, Lee R, McKay S, Muller HM, Nakamura C, Petcherski A, Rangarajan A, Rogers A, Schindelman G, Schwarz EM, Spooner W, Tuli MA, Van Auken K, Wang D, Wang X, Williams G, Durbin R, Stein LD, Sternberg PW, Spieth J: WormBase: new content and better access.

    Nucleic Acids Res 2007, (35 Database):D506-10. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  28. Cameron S, Clark SG, McDermott JB, Aamodt E, Horvitz HR: PAG-3, a Zn-finger transcription factor, determines neuroblast fate in C. elegans.

    Development 2002, 129(7):1763-74. PubMed Abstract | Publisher Full Text OpenURL

  29. Rocheleau CE, Howard RM, Goldman AP, Volk ML, Girard LJ, Sundaram MV: A lin-45 raf enhancer screen identifies eor-1, eor-2 and unusual alleles of Ras pathway genes in Caenorhabditis elegans.

    Genetics 2002, 161:121-31. PubMed Abstract | PubMed Central Full Text OpenURL

  30. Uchida O, Nakano H, Koga M, Ohshima Y: The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons.

    Development 2003, 130(7):1215-24. PubMed Abstract | Publisher Full Text OpenURL

  31. Wylie T, Martin J, Dante M, Mitreva M, Clifton S, Chinwalla A, Waterston R, Wilson R, McCarter J: Nematode.net: a tool for navigating sequences from parasitic and free-living nematodes.

    Nucleic Acids Res 2004, (32 Database):D423-6. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  32. Hore TA, Deakin JE, Marshall Graves JA: The evolution of epigenetic regulators CTCF and BORIS/CTCFL in amniotes.

    PLoS Genet 2008, 4(8):e1000169. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. Klenova E, Fagerlie S, Filippova G, Kretzner L, Goodwin G, Loring G, Neiman P, Lobanenkov V: Characterization of the chicken CTCF genomic locus, and initial study of the cell cycle-regulated promoter of the gene.

    J Biol Chem 1998, 273(41):26571-9. PubMed Abstract | Publisher Full Text OpenURL

  34. Suzuki M, Gerstein M, Yagi N: Stereochemical basis of DNA recognition by Zn fingers.

    Nucleic Acids Res 1994, 22(16):3397-405. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  35. Savard J, Tautz D, Lercher MJ: Genome-wide acceleration of protein evolution in flies (Diptera).

    BMC Evol Biol 2006, 6:7. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  36. Zdobnov EM, Bork P: Quantification of insect genome divergence.

    Trends Genet 2007, 23:16-20. PubMed Abstract | Publisher Full Text OpenURL

  37. Zlatanova J, Caiafa P: CTCF and its protein partners: divide and rule?

    J Cell Sci 2009, 122(Pt 9):1275-84. PubMed Abstract | Publisher Full Text OpenURL

  38. Attwood TK, Beck ME, Bleasby AJ, Parry-Smith DJ: PRINTS – a database of protein motif fingerprints.

    Nucleic Acids Res 1994, 22(17):3590-6. PubMed Abstract | PubMed Central Full Text OpenURL

  39. Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C, Langendijk-Genevaux PS, Sigrist CJ: The 20 years of PROSITE.

    Nucleic Acids Res 2008, (36 Database):D245-9. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  40. Klenova E, Chernukhin I, El-Kady A, Lee R, Pugacheva E, Loukinov D, Goodwin G, Delgado D, Filippova G, Leon J, Morse H 3rd, Neiman P, Lobanenkov V: Functional phosphorylation sites in the C-terminal region of the multivalent multifunctional transcriptional factor CTCF.

    Mol Cell Biol 2001, 21(6):2221-34. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  41. Mitreva M, Jasmer DP: Biology and genome of Trichinella spiralis.

    WormBook 2006, 1-21. PubMed Abstract | Publisher Full Text OpenURL

  42. Zarlenga DS, Rosenthal B, Hoberg E, Mitreva M: Integrating genomics and phylogenetics in understanding the history of Trichinella species.

    Vet Parasitol 2009, 159(3–4):210-3. PubMed Abstract | Publisher Full Text OpenURL

  43. Vanfleteren JR, Peer Y, Blaxter ML, Tweedie SA, Trotman C, Lu L, Van Hauwaert ML, Moens L: Molecular genealogy of some nematode taxa as based on cytochrome c and globin amino acid sequences.

    Mol Phylogenet Evol 1994, 3(2):92-101. PubMed Abstract | Publisher Full Text OpenURL

  44. Ramos E, Ghosh D, Baxter E, Corces VG: Genomic organization of gypsy chromatin insulators in Drosophila melanogaster.

    Genetics 2006, 172(4):2337-49. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  45. Cuddapah S, Jothi R, Schones DE, Roh TY, Cui K, Zhao K: Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains.

    Genome Res 2009, 19(1):24-32. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  46. Meyer BJ: X-Chromosome dosage compensation.

    WormBook 2005, 1-14. PubMed Abstract | Publisher Full Text OpenURL

  47. Simpson VJ, Johnson TE, Hammen RF: Caenorhabditis elegans DNA does not contain 5-methylcytosine at any time during development or aging.

    Nucleic Acids Res 1986, 14(16):6711-9. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  48. Hendrich B, Tweedie S: The methyl-CpG binding domain and the evolving role of DNA methylation in animals.

    Trends Genet 2003, 19(5):269-77. PubMed Abstract | Publisher Full Text OpenURL

  49. Gutierrez A, Sommer R: Evolution of dnmt-2 and mbd-2-like genes in the free-living nematodes Pristionchus pacificus, Caenorhabditis elegans and Caenorhabditis briggsae.

    Nucleic Acids Res 2004, 32(21):6388-96. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  50. Tweedie S, Charlton J, Clark V, Bird A: Methylation of genomes and genes at the invertebrate-vertebrate boundary.

    Mol Cell Biol 1997, 17(3):1469-75. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  51. Hwang SB, Lee J: Neuron cell type-specific SNAP-25 expression driven by multiple regulatory elements in the nematode Caenorhabditis elegans.

    J Mol Biol 2003, 333(2):237-47. PubMed Abstract | Publisher Full Text OpenURL

  52. Ji Q, Hashmi S, Liu Z, Zhang J, Chen Y, Huang CH: CeRh1 (rhr-1) is a dominant Rhesus gene essential for embryonic development and hypodermal function in Caenorhabditis elegans.

    Proc Natl Acad Sci USA 2006, 103(15):5881-6. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  53. Reece-Hoyes JS, Shingles J, Dupuy D, Grove CA, Walhout AJ, Vidal M, Hope IA: Insight into transcription factor gene duplication from Caenorhabditis elegans Promoterome-driven expression patterns.

    BMC Genomics 2007, 8:27. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  54. Chang YL, King BO, O'Connor M, Mazo A, Huang DH: Functional reconstruction of trans regulation of the Ultrabithorax promoter by the products of two antagonistic genes, trithorax and Polycomb.

    Mol Cell Biol 1995, 15(12):6601-12. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  55. Li Q, Harju S, Peterson KR: Locus control regions: coming of age at a decade plus.

    Trends Genet 1999, 15(10):403-8. PubMed Abstract | Publisher Full Text OpenURL

  56. Schierenberg E: Unusual cleavage and gastrulation in a freshwater nematode: developmental and phylogenetic implications.

    Dev Genes Evol 2005, 215(2):103-8. PubMed Abstract | Publisher Full Text OpenURL

  57. Zugasti O, Rajan J, Kuwabara PE: The function and expansion of the Patched- and Hedgehog-related homologs in C. elegans.

    Genome Res 2005, 15(10):1402-10. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  58. Burglin TR: Evolution of hedgehog and hedgehog-related genes, their origin from Hog proteins in ancestral eukaryotes and discovery of a novel Hint motif.

    BMC Genomics 2008, 9:127. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  59. Ruvkun G, Hobert O: The taxonomy of developmental control in Caenorhabditis elegans.

    Science 1998, 282(5396):2033-41. PubMed Abstract | Publisher Full Text OpenURL

  60. Aboobaker A, Blaxter M: Hox Gene Loss during Dynamic Evolution of the Nematode Cluster.

    Curr Biol 2003, 13:37-40. PubMed Abstract | Publisher Full Text OpenURL

  61. Schulze J, Schierenberg E: Cellular pattern formation, establishment of polarity and segregation of colored cytoplasm in embryos of the nematode Romanomermis culicivorax.

    Dev Biol 2008, 315(2):426-36. PubMed Abstract | Publisher Full Text OpenURL

  62. Schulze J, Schierenberg E: Embryogenesis of Romanomermis culicivorax: An alternative way to construct a nematode.

    Dev Biol 2009, in press. PubMed Abstract | Publisher Full Text OpenURL

  63. Blumenthal T, Evans D, Link CD, Guffanti A, Lawson D, Thierry-Mieg J, Thierry-Mieg D, Chiu WL, Duke K, Kiraly M, Kim SK: A global analysis of Caenorhabditis elegans operons.

    Nature 2002, 417(6891):851-4. PubMed Abstract | Publisher Full Text OpenURL

  64. Spieth J, Brooke G, Kuersten S, Lea K, Blumenthal T: Operons in C. elegans: polycistronic mRNA precursors are processed by trans-splicing of SL2 to downstream coding regions.

    Cell 1993, 73(3):521-32. PubMed Abstract | Publisher Full Text OpenURL

  65. Evans D, Zorio D, MacMorris M, Winter C, Lea K, Blumenthal T: Operons and SL2 trans-splicing exist in nematodes outside the genus Caenorhabditis.

    Proc Natl Acad Sci USA 1997, 94(18):9751-6. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  66. Lee K, Sommer R: Operon structure and trans-splicing in the nematode Pristionchus pacificus.

    Mol Biol Evol 2003, 20(12):2097-103. PubMed Abstract | Publisher Full Text OpenURL

  67. Stein LD, Bao Z, Blasiar D, Blumenthal T, Brent MR, Chen N, Chinwalla A, Clarke L, Clee C, Coghlan A, Coulson A, D'Eustachio P, Fitch DH, Fulton LA, Fulton RE, Griffiths-Jones S, Harris TW, Hillier LW, Kamath R, Kuwabara PE, Mardis ER, Marra MA, Miner TL, Minx P, Mullikin JC, Plumb RW, Rogers J, Schein JE, Sohrmann M, Spieth J, Stajich JE, Wei C, Willey D, Wilson RK, Durbin R, Waterston RH: The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics.

    PLoS Biol 2003, 1(2):E45. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  68. Guiliano D, Blaxter M: Operon conservation and the evolution of trans-splicing in the phylum Nematoda.

    PLoS Genet 2006, 2(11):e198. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  69. Ghedin E, Wang S, Spiro D, Caler E, Zhao Q, Crabtree J, Allen JE, Delcher AL, Guiliano DB, Miranda-Saavedra D, Angiuoli SV, Creasy T, Amedeo P, Haas B, El-Sayed NM, Wortman JR, Feldblyum T, Tallon L, Schatz M, Shumway M, Koo H, Salzberg SL, Schobel S, Pertea M, Pop M, White O, Barton GJ, Carlow CK, Crawford MJ, Daub J, Dimmic MW, Estes CF, Foster JM, Ganatra M, Gregory WF, Johnson NM, Jin J, Komuniecki R, Korf I, Kumar S, Laney S, Li BW, Li W, Lindblom TH, Lustigman S, Ma D, Maina CV, Martin DM, McCarter JP, McReynolds L, Mitreva M, Nutman TB, Parkinson J, Peregrin-Alvarez JM, Poole C, Ren Q, Saunders L, Sluder AE, Smith K, Stanke M, Unnasch TR, Ware J, Wei AD, Weil G, Williams DJ, Zhang Y, Williams SA, Fraser-Liggett C, Slatko B, Blaxter ML, Scott AL: Draft genome of the filarial nematode parasite Brugia malayi.

    Science 2007, 317(5845):1756-60. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  70. Opperman CH, Bird DM, Williamson VM, Rokhsar DS, Burke M, Cohn J, Cromer J, Diener S, Gajan J, Graham S, Houfek TD, Liu Q, Mitros T, Schaff J, Schaffer R, Scholl E, Sosinski BR, Thomas VP, Windham E: Sequence and genetic map of Meloidogyne hapla: A compact nematode genome for plant parasitism.

    Proc Natl Acad Sci USA 2008, 105(39):14802-7. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  71. Pettitt J, Muller B, Stansfield I, Connolly B: Spliced leader trans-splicing in the nematode Trichinella spiralis uses highly polymorphic, noncanonical spliced leaders.

    RNA 2008, 14(4):760-70. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  72. Lindh JG, Connolly B, McGhie DL, Smith DF: Identification of a developmentally regulated Trichinella spiralis protein that inhibits MyoD-specific protein: DNA complexes in vitro.

    Mol Biochem Parasitol 1998, 92:163-75. PubMed Abstract | Publisher Full Text OpenURL

  73. Qian W, Zhang J: Evolutionary dynamics of nematode operons: easy come, slow go.

    Genome Res 2008, 18(3):412-21. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  74. Dieterich C, Clifton SW, Schuster LN, Chinwalla A, Delehaunty K, Dinkelacker I, Fulton L, Fulton R, Godfrey J, Minx P, Mitreva M, Roeseler W, Tian H, Witte H, Yang SP, Wilson RK, Sommer RJ: The Pristionchus pacificus genome provides a unique perspective on nematode lifestyle and parasitism.

    Nat Genet 2008, 40(10):1193-8. PubMed Abstract | Publisher Full Text OpenURL

  75. Rice P, Longden I, Bleasby A: EMBOSS: the European Molecular Biology Open Software Suite.

    Trends Genet 2000, 16(6):276-7. PubMed Abstract | Publisher Full Text OpenURL

  76. Altschul S, Gish W, Miller W, Myers E, Lipman D: Basic local alignment search tool.

    J Mol Biol 1990, 215(3):403-10. PubMed Abstract | Publisher Full Text OpenURL

  77. Renda M, Baglivo I, Burgess-Beusse B, Esposito S, Fattorusso R, Felsenfeld G, Pedone PV: Critical DNA binding interactions of the insulator protein CTCF: a small number of zinc fingers mediate strong binding, and a single finger-DNA interaction controls binding at imprinted loci.

    J Biol Chem 2007, 282(46):33336-45. PubMed Abstract | Publisher Full Text OpenURL

  78. Eddy S: Profile hidden Markov models.

    Bioinformatics 1998, 14(9):755-63. PubMed Abstract | Publisher Full Text OpenURL

  79. Edgar R: MUSCLE: a multiple sequence alignment method with reduced time and space complexity.

    BMC Bioinformatics 2004, 5:113. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  80. Galtier N, Gouy M, Gautier C: SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny.

    Comput Appl Biosci 1996, 12(6):543-8. PubMed Abstract OpenURL

  81. Beitz E: TEXshade: shading and labeling of multiple sequence alignments using LATEX2 epsilon.

    Bioinformatics 2000, 16(2):135-9. PubMed Abstract | Publisher Full Text OpenURL

  82. Gray C, Coates C: Cloning and characterization of cDNAs encoding putative CTCFs in the mosquitoes, Aedes aegypti and Anopheles gambiae.

    BMC Mol Biol 2005, 6:16. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  83. Abascal F, Zardoya R, Posada D: ProtTest: selection of best-fit models of protein evolution.

    Bioinformatics 2005, 21(9):2104-5. PubMed Abstract | Publisher Full Text OpenURL

  84. Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.

    Syst Biol 2003, 52(5):696-704. PubMed Abstract | Publisher Full Text OpenURL

  85. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models.

    Bioinformatics 2003, 19(12):1572-4. PubMed Abstract | Publisher Full Text OpenURL

  86. Swofford DL: PAUP* Phylogenetic Analysis using Parsimony (* and other Methods). Version 4. Sunderland, Massachusetts: Sinauer Associates; 1998. OpenURL

  87. Page RD: TreeView: an application to display phylogenetic trees on personal computers.

    Comput Appl Biosci 1996, 12(4):357-8. PubMed Abstract OpenURL

  88. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream M, Barrell B: Artemis: sequence visualization and annotation.

    Bioinformatics 2000, 16(10):944-5. PubMed Abstract | Publisher Full Text OpenURL

  89. Gordon D, Abajian C, Green P: Consed: a graphical tool for sequence finishing.

    Genome Res 1998, 8(3):195-202. PubMed Abstract | Publisher Full Text OpenURL

  90. Ewing B, Green P: Base-calling of automated sequencer traces using phred. II. Error probabilities.

    Genome Res 1998, 8(3):186-94. PubMed Abstract | Publisher Full Text OpenURL

  91. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers.

    Methods Mol Biol 2000, 132:365-86. PubMed Abstract OpenURL