Table 2

Primers used

Primer name

Sequence


ftsZ sense

CGAGATTGTCCCTGGTCGG


ftsZ antisense

TGGCTACTTCTGCTACGATTGGAG


rbcL tagged RT

CAACAGACGCACGACGCAGCAGACGAAACGGATATCTTCTAGAC


rbcL sense PCR

CGTTCCGCATGACACCCCAGCC


antisense TAG

CAACAGACGCACGACGCAGCAGAC


Sequence of primers used for this work. For genomic DNA detection ftsZ specific primers were used. During reverse transcriptase one tagged antisense oligonucleotide was used to prime cDNA synthesis. PCR amplification of the cDNA used one rbcL specific sense primer while the tag was used as an antisense primer.

Pinto et al. BMC Molecular Biology 2009 10:79   doi:10.1186/1471-2199-10-79

Open Data