Table 1

Primer name

Sequence


Myb prom FOR

ACTGCAGGGGCGCCAGATTT


Myb prom REV

GGAGAAAGGGGAGGAGAAGGAGGTA


Neg myb FOR

GAAGTAGAGGCAGGATAATCAGGAA


Neg myb REV

AGGATGAACCAGGGCTAATGC


EKLF Upstream FOR

CTGGCCCCCCTACCTGAT


EKLF Upstream REV

GGCTCCCTTTCAGGCATTATC


EKLF Promoter FOR

TATCGCACACACCCCTCCTT


EKLF Promoter REV

CCCACATCTGATTGGCTGTCT


Neg EKLF FOR

TGCTCCCCACTATGATAATGGA


Neg EKLF REV

GCCACAACCAAAGAAGACATTTT


Necdin FOR

GGTCCTGCTCTGATCCGAAG


Necdin REV

GGGTCGCTCAGGTCCTTACTT


Amylase FOR

CTCCTTGTACGGGTTGGT


Amylase REV

AATGATGTGCACAGCTGAA


Kolodziej et al. BMC Molecular Biology 2009 10:6   doi:10.1186/1471-2199-10-6

Open Data