Open Access Research article

Requirements for E1A dependent transcription in the yeast Saccharomyces cerevisiae

Ahmed F Yousef1, Christopher J Brandl2 and Joe S Mymryk1,3*

Author Affiliations

1 Department of Microbiology & Immunology, University of Western Ontario, London, Ontario, Canada

2 Department of Biochemistry, University of Western Ontario, London, Ontario, Canada

3 Department of Oncology, University of Western Ontario, London, Ontario, Canada

For all author emails, please log on.

BMC Molecular Biology 2009, 10:32 doi:10.1186/1471-2199-10-32


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2199/10/32


Received:17 December 2008
Accepted:17 April 2009
Published:17 April 2009

© 2009 Yousef et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The human adenovirus type 5 early region 1A (E1A) gene encodes proteins that are potent regulators of transcription. E1A does not bind DNA directly, but is recruited to target promoters by the interaction with sequence specific DNA binding proteins. In mammalian systems, E1A has been shown to contain two regions that can independently induce transcription when fused to a heterologous DNA binding domain. When expressed in Saccharomyces cerevisiae, each of these regions of E1A also acts as a strong transcriptional activator. This allows yeast to be used as a model system to study mechanisms by which E1A stimulates transcription.

Results

Using 81 mutant yeast strains, we have evaluated the effect of deleting components of the ADA, COMPASS, CSR, INO80, ISW1, NuA3, NuA4, Mediator, PAF, RSC, SAGA, SAS, SLIK, SWI/SNF and SWR1 transcriptional regulatory complexes on E1A dependent transcription. In addition, we examined the role of histone H2B ubiquitylation by Rad6/Bre1 on transcriptional activation.

Conclusion

Our analysis indicates that the two activation domains of E1A function via distinct mechanisms, identify new factors regulating E1A dependent transcription and suggest that yeast can serve as a valid model system for at least some aspects of E1A function.

Background

Human adenovirus type 5 (HAdV-5) early region 1A (E1A) is the first viral gene expressed during infection and plays a critical role in transcriptional activation [1,2]. The primary E1A transcript is differentially spliced, yielding mRNAs encoding two major products of 289 residues (R) and 243R respectively (Figure 1A). These proteins share identical amino and carboxyl sequences and only differ by the presence of an additional 46 amino acids in the 289R protein [2,3]. The region unique to the 289R E1A protein is highly conserved amongst the E1A proteins of different adenovirus serotypes, and is referred to as conserved region 3 (CR3) [4-6]. The 289R E1A protein is thought to be primarily responsible for activation of gene expression, as mutations within CR3 generally abolish E1A transactivation [7-11]. An adjacent acidic region spanning residues 189–200, termed Auxiliary Region 1 (AR1), is also essential for efficient transactivation of early viral promoters by E1A [12].

thumbnailFigure 1. Map of the major adenovirus type 5 E1A proteins and transcriptional activation by LexA-E1A fusions. A) The two major products of E1A are 289 and 243 residues (R) in length and differ only by the presence of an additional 46 amino acids unique to the larger protein. Regions of sequence conservation relevant to this study (CR) are shown as are the regions expressed as LexA DBD fusions. B) Yeast strain BY4741 was transformed with the pSH1834 LexA responsive reporter plasmid and vectors expressing the LexA DBD, or the LexA DBD fused to the indicated portions of E1A. Extracts were prepared from transformed yeast and assayed for β-galactosidase activity as described previously [29]. Experiments were performed in triplicate with s.d's indicated.

The mechanism by which CR3 of E1A activates transcription has been studied intensely. CR3 binds numerous sequence specific transcription factors [13-17] via a promoter targeting region embedded within CR3 [15]. These interactions are thought to localize E1A to target promoters in the infected cell. When tethered to DNA by fusion to a heterologous DNA binding domain (DBD), the need for the promoter targeting region is bypassed and CR3 functions as a powerful transcriptional activator [18].

Mutations within the promoter targeting region exhibit a dominant negative effect on transcriptional activation by wild-type E1A [19,20], suggesting that these mutants sequester limiting factors necessary for transactivation by wild-type E1A. The first of these limiting factors to be identified was TBP [21]. The Sur2/TRAP150β/Med23 component of the Mediator/TRAP complex was identified to be the second critical target of CR3 [22,23]. Distinct roles for different proteasome complexes and p300/CBP in CR3 dependent transcription have also been shown [24,25].

When fused to a heterologous DBD, a second transactivation domain was identified within the N-terminal/CR1 portion of E1A [26]. This region of E1A binds multiple transcriptional regulators, including the p300, CBP (CREB Binding Protein) and pCAF acetyltransferases, TBP, TRRAP and p400 [27]. Paradoxically, this region functions as a transcriptional repression domain in the context of the E1A 243R protein by sequestering limiting factors, such as p300 and CBP, from cellular transcription factors [2]. Indeed, recent work has shown that expression of E1A 12S induces global changes in histone H3 K18 acetylation, consistent with the sequestration/retargeting of p300/CBP by E1A [28].

E1A is the product of a virus that infects human cells. However, both domains of E1A that function in mammalian cells as transcriptional activators when fused to a heterologous DBD also function as transcriptional activators in yeast [29]. Indeed, yeast have been exploited extensively as a model system to genetically study the mechanisms of E1A action [30-33,29,24].

Using a yeast model system, we have evaluated the role of histone modifying and chromatin remodelling complexes on the activity of the two transcriptional activation domains of HAdV-5 E1A. These results show that the two activation domains of E1A function via distinct but overlapping mechanisms and suggest that yeast can serve as a valid model system for identifying new targets of E1A involved in transcriptional regulation.

Results and discussion

LexA DBD fusions of E1A activate transcription in yeast

E1A contains two independent regions that function as transcriptional activation domains when expressed as DBD fusions in mammalian cells. We have previously shown that these same regions function as transcriptional activation domains in yeast when fused to the Gal4 DBD [29,24]. To apply yeast genetic approaches to further understand how E1A influences transcription, we assessed the role of histone modifying and chromatin remodelling complexes on the activity of these two transcriptional activation domains of HAdV-5 E1A. Specifically, we expressed the N-terminal 82 amino acids of E1A and the region spanning residues 139–204, which encompasses CR3 and AR1 of E1A, as fusions to the LexA DBD (Fig. 1A). The E. coli derived LexA DBD was chosen instead of the yeast Gal4 DBD to eliminate confounding effects of normal Gal4 regulation on the transcriptional activity of the E1A fusions. In addition, the LexA-E1A fusions did not inhibit yeast growth as substantially as the corresponding Gal4 DBD fusions [29]. Importantly, both portions of E1A retained transcriptional activation function as LexA DBD fusions (Fig. 1B).

Role of the SAGA, ADA and SLIK chromatin modifying complexes

We transformed plasmids expressing each E1A activation domain as a LexA DBD fusion as well as a β-galactosidase reporter gene under the control of a LexA responsive element into the wild-type yeast strain BY4741 and isogenic strains in which components of the SAGA and related ADA and SLIK complexes were disrupted (Figure 2). SAGA components can be subdivided into four general classes. Ada1, Spt7 and Spt20 are required for the structural integrity of the complex and their disruption resulted in a complete abrogation of activation dependent on the E1A N-terminus. Gcn5, Ada2 and Ada3 are necessary for acetyltransferase activity, and their disruption also impaired activation by the E1A N-terminus. Indeed, the Gcn5 acetyltransferase appeared to be the most important component of this module as its loss resulted in a 68% decrease in activity (Figure 2). Spt3 and Spt8 function in TBP recruitment by the complex and their disruption reduced activation by the N-terminus of E1A, although loss of Spt3 had a more profound effect. Recent work has shown that Spt3 directly contacts TBP and that this interaction is critical for recruiting TBP to SAGA-dependent promoters and stimulating transcription [34]. Ubp8 and Sgf11 comprise the histone deubiquitylation module in SAGA, and did not influence activation by the N-terminus of E1A. Deletion of Sgf73 and Rtg2 also reduced activation by the N-terminus of E1A, whereas the Ahc1 component of the ADA complex was not required. Based on these results, transcriptional activation by the N-terminus of E1A is primarily dependent on the components necessary to maintain the integrity of SAGA/SLIK [35] and the TBP recruitment function of Spt3 in particular, but is less dependent on the Gcn5 acetyltransferase and the Ubp8 deubiquitinase activities. Although transcriptional activation by the N-terminus of E1A in yeast does not require the ADA complex, it requires SAGA/SLIK, which may in some cases possess overlapping activities [36]. Similarly to the N-terminus, activation by E1A CR3 required the structural integrity of the SAGA complex, the TBP recruitment function of Spt3 and was independent of the ADA specific component Ahc1 (Figure 2). However, CR3 was more dependent on the SAGA acetyltransferase components (gcn5Δ, ada2Δ and ada3Δ) and the Ubp8 deubiquitinase, and was not influenced by the SLIK specific component Rtg2 (Figure 2). Western blot analysis confirmed that E1A was still expressed in these strains (Additional file 1).

Additional file 1. Western Blot analysis of LexA-DBD-CR3 expression levels in selected yeast disruption strains. The data provided show the relative levels of expression of LexA-DBD-CR3 in selected yeast strains.

Format: EPS Size: 455KB Download fileOpen Data

thumbnailFigure 2. Influence of the SAGA, ADA and SLIK complexes on E1A dependent transcriptional activation. The indicated yeast deletion strains isogenic to BY4741 (refer to Additional file 2) were transformed with the pSH1834 LexA responsive reporter plasmid and vectors expressing the LexA DBD, or the LexA DBD fused to the indicated portions of E1A. Extracts were prepared from transformed yeast and assayed for β-galactosidase activity as described previously [29] and detailed in the Methods. Experiments were performed in triplicate with s.d's indicated. The asterisks indicate which complexes are expected to be influenced by the individual gene disruptions, as several of these genes encode factors that are components of more than one complex. For example, Spt3 is a component of the SAGA and SLIK complexes, but not the ADA complex.

Our previous work showed that the N-terminal and CR3 regions of E1A fused to the Gal4 DBD inhibits yeast growth in a SAGA dependent fashion. In that study, disruption of any SAGA component, including Gcn5 and Ada3/Ngg1 abrogated growth inhibition by either the N-terminus or CR3 [29]. Another study also showed that growth inhibition by the N-terminus of E1A required numerous other SAGA components [37]. Based on these observations, growth inhibition is clearly related to interaction with the SAGA complex, but is not a direct result of E1A dependent transcriptional activation. In mammalian cells, the N-terminus of E1A binds pCAF[38] and mammalian GCN5 [39], the two human orthologues of yeast Gcn5. These interactions are important, as it is known that E1A is transiently recruited to a subset of cellular promoters that are associated with cell cycle control and growth during infection. E1A induces a localized enrichment of histone acetyltransferases, including pCAF, at these loci and activates transcription [40].

Influence of the Mediator complex on E1A dependent transcriptional activation in yeast

In yeast, like higher eukaryotic cells, the Mediator complex interacts with RNA polymerase II and functions as both a coactivator and corepressor [41]. It is well established that E1A CR3 targets the Sur2/TRAP150β/Med23 component of the Mediator/TRAP complex in mammalian cells, which is necessary for efficient transcriptional activation [22,23]. Yeast Mediator is comprised of the Gal11, Med9/10 and Srb4 modules, and Gal11 is the Sur2/TRAP150β/Med23 orthologue [42]. We examined E1A dependent activation in strains lacking the non-essential components of the mediator complex (Figure 3). Interestingly, activation by the N-terminus of E1A decreased in all Mediator knockout strains, regardless of which module was targeted (Figure 3). This suggests that the N-terminus requires multiple Mediator modules, either directly or indirectly to stimulate transcription. In contrast, activation by CR3 was reduced only by deletion of the Srb5 or Rox3 components of the Srb4 module. Deletion of Gal11, the yeast orthologue of Sur2/TRAP150β/Med23, or the Pdg1 and Sin4 components of the Gal11 module had no effect on CR3 dependent activation. These results indicate that CR3 dependent activation in yeast is not as strongly dependent on Mediator as it is in mammalian cells.

thumbnailFigure 3. Influence of Mediator on E1A dependent transcriptional activation in yeast. Experiments were performed as in Figure 2. The asterisks indicate which modules are expected to be influenced by the individual gene disruptions.

Role of the SWI/SNF chromatin remodelling complex in E1A dependent transcriptional activation in yeast

The SWI/SNF complex alters chromatin structure in an ATP-dependent manner [43]. Activation by the E1A N-terminal domain fused to the LexA DBD was reduced in most yeast strains lacking components of SWI/SNF with the exception of the swi3Δ, snf11Δ and swp73Δ strains (Figure 4). Similarly, activation by CR3 was also decreased in yeast lacking multiple components of the SWI/SNF complex, including the swi3Δ strain (Figure 4). However, impairment of CR3 activation was more profound in these strains. These results suggest that the SWI/SNF dependent chromatin remodelling complex is targeted by both activation domains of E1A, but is more critical for CR3 dependent transcriptional activation. Others have reported that targeted histone acetylation by the SAGA complex predisposes promoter nucleosomes for displacement by the SWI/SNF complex, in a Snf2 dependent fashion [44]. In agreement with this, CR3 dependent activation is more dependent on the Gcn5 acetyltransferase function of SAGA and the Snf2 ATPase of the SWI/SNF complex than is activation by the N-terminus of E1A (Figures 2 and 4). A genetic screen in yeast previously identified the SWI/SNF complex as a target of the N-terminus of E1A [30]. That study demonstrated that the N-terminus of E1A blocked SWI/SNF function and inhibited yeast growth. In mammalian cells, the N-terminus of E1A interacts with p400, a SWI2 family member [45]. Although this interaction is required for oncogenic transformation by low levels of E1A [45] and suppression of EGFR expression [46], the exact effects of this interaction on transcriptional activation by E1A are not clear. A role for SWI/SNF in transcriptional activation by CR3 in mammalian cells has not been shown. Our results in yeast suggest that this could be a promising area of future investigation.

thumbnailFigure 4. Influence of the SWI/SNF complex on E1A dependent transcriptional activation in yeast. Experiments were performed as in Figure 2.

Influence of Bre1, Rad6, COMPASS/Set1C complex and Dot1 complex on E1A dependent transcriptional activation in yeast

Human Bre1, a histone H2B-specific ubiquitin ligase, functions as a coactivator by increasing human H2B K120 ubiquitylation and histone H3 K4 and K79 trimethylation [47,48]. CR3 activity was reduced in a bre1Δ strain to less than 8% activity (Figure 5A). Furthermore, disruption of RAD6, the corresponding ubiquitin conjugase, or conversion of the yeast H2B target lysine to arginine (K123R) also abrogated CR3 dependent activation to levels of less than 10%. Loss of Bur2, which is required for histone H2B monoubiquitination and functions as a component of the kinase complex that phosphorylates Rad6 [49], reduced CR3 dependent activation to a lesser extent. CR3 expression was not reduced in these strains (Additional file 1). However, deletion of the genes encoding the Ubc5 or Ubc8 ubiquitin conjugases, the Rad6 interacting ubiquitin ligase Ubr2, or the Rad6 interactor Rad18, which are not involved in histone ubiquitylation, reduced CR3 dependent activity to levels similar to that observed in the bur2Δ strain (Figure 5A). These results suggest a key role for Bre1 and Rad6 mediated ubiquitylation of H2B in CR3 dependent activation in yeast. Interestingly, deletion of the Ubp8 SAGA component, which removes the ubiquitin group from H2B K123, is also impaired for CR3 dependent activation (Figure 2). A reduction in SAGA dependent transcription has been observed previously in ubp8Δ yeast [50].

thumbnailFigure 5. Influence of Bre1, Rad6, COMPASS/Set1C complex and Dot1 complex on E1A dependent transcriptional activation in yeast. Experiments were performed as in Figure 2. A) Bre1, Rad6 and related deletion strains. B) COMPASS/Set1C and Dot1 deletion strains.

Similarly to CR3, transcriptional activation by the N-terminus of E1A was reduced in most of these strains (Figure 5A). However, the level of impairment was not as pronounced as observed with CR3. Unexpectedly, the reductions observed in the bre1Δ and rad6Δ strains were not reflected in a similar reduction in the H2B K123R strain, suggesting that the Bre1/Rad6 ubiquitinylation complex may have additional targets beyond H2B K123. A possibility that is supported by our observation that the Ubp8 deubiquitinase, which removes the ubiquitin moiety from H2B K123, is similarly not required for activation by the N-terminus (Figure 2).

Ubiquitylation of histone H2B K123 is required for trimethylation of histone H3 K4 and K79, modifications often associated with active transcription [51]. We next tested the role of H3 K4 methylation in E1A activity using strains lacking components of the COMPASS/Set1C complex. Deletion of Bre2, Sdc1 or Spp1, which are preferentially required to direct H3 K4 trimethylation [52], impair CR3 function (Figure 5B). Deletion of the Swd1, Swd3 and Shg1 components of the complex also reduced CR3 dependent activation (Figure 5B). CR3 expression was not reduced in these strains (Additional file 1). H3 K79 methylation in yeast is mediated by Dot1, and activation by CR3 was reduced in the dot1Δ strain by about 50% (Figure 5B). These results suggest that recruitment of a Bre1 orthologue and accompanying H3 K4 trimethylation may be an important component of CR3 dependent activation by E1A in mammalian cells, which deserves future study. Activation by the N-terminus of E1A was reduced to a lesser extent in these strains compared to CR3 and was not substantially affected by the deletion of Sdc1 and Dot1 (Figure 5B). These results substantiate the data presented in Figure 5A, suggesting that H2B ubiquitinylation and subsequent H3 K4 methylation are not as critical for activation by the N-terminus of E1A as they are for CR3.

Influence of the ISW1 complexes and Spt4 on E1A dependent transcriptional activation in yeast

H3 K4 trimethylation by Set1 has been reported to stimulate recruitment of Isw1 and its associated complexes to chromatin [53]. However, the ISW1 complexes don't play general roles in transcriptional regulation as knockout of the Isw1 ATPase component of the complex does not effect yeast growth. This complex appears to repress a subset of yeast genes as about 140 genes are activated by more than 1.5-fold in an isw1Δ strain [54]. Deletion of components of the ISW1 complex reduced activation by the N-terminus of E1A modestly or not at all in the case of Ioc4 (Figure 6). However, loss of any component of the complex stimulated CR3 dependent activation. Given that CR3 dependent transcriptional activation depends on COMPASS/Set1C induced H3 K4 trimethylation (Figure 5B), it would be predicted that this modification would lead to enhanced recruitment of the repressive ISW1 chromatin remodelling complexes. Thus, in the absence of ISW1 components, CR3 could function more effectively, which is what was observed.

thumbnailFigure 6. Influence of the ISW1 complex and Spt4 on E1A dependent transcriptional activation in yeast. Experiments were performed as in Figure 2.

The conversion of RNA polymerase into an elongating form is influenced by DRB Sensitivity Inducing Factor (DSIF) [55,56]. DSIF in yeast is comprised of Spt5, which is an essential protein, and Spt4 which is not. Interestingly, transcriptional activation by either portion of E1A was abrogated in the spt4Δ strain (Figure 6), suggesting that both activation domains of E1A also influence transcriptional elongation in yeast and that this may be a good system to further study this activity.

Influence of the INO80, NuA3, NuA4, PAF, RSC, SAS, CSC and SWR1 complexes on E1A dependent transcriptional activation in yeast

We tested yeast strains lacking components of the INO80, RSC, SWR1 ATP dependent chromatin remodelling complexes, the NuA3, NuA4 and SAS acetylation complexes, the CSC silencing complex, the PAF lysine methyltransferase complex and several arginine methyltransferases for their effects on E1A dependent activation (Additional file 2). In general, relatively modest changes were observed, with a few exceptions where a single unique component of a complex affected E1A dependent transcription. No direct explanation could be found for these results, although we noted that many of these genes had synthetic genetic phenotypes with other transcriptional regulators essential for E1A dependent transactivation. Future developments in understanding the unique effects of these proteins may lead to additional understanding of E1A dependent transcription.

Additional file 2. Fold activation relative to wild-type in different yeast deletion strains isogenic to BY4741. The data provided show the relative fold activation of LexA-DBD-N-terminus and LexA-DBD-CR3 in additional yeast disruption strains.

Format: XLS Size: 24KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

The possibility remains that disruption of certain genes could alter the copy number of the pSH1834 reporter construct used in these studies. To test this, a cassette consisting of the LexA responsive Lacz reporter was integrated into the GAL1 locus by homologous recombination in five randomly selected deletion strains. Results obtained using the integrated reporter or pSH1834 were comparable (Additional file 3), suggesting that any changes in reporter plasmid copy number caused by these individual gene disruptions did not substantially influence the results obtained in these strains. However, it remains a possibility that changes in copy number might contribute to small differences in activation in other strains.

Additional file 3. Reporter copy number variation in yeast disruption strains and effect of different methods of preparing yeast extract on E1A-dependent transcriptional activation. The data provided show the effect of changing the copy number of the reporter or method of preparing yeast extracts on E1A dependent transcriptional activation in selected yeast strains.

Format: EPS Size: 138KB Download fileOpen Data

Conclusion

In conclusion, our analysis of the influence of chromatin remodelling and histone modifying complexes on E1A dependent activation of transcription in S. cerevisiae provides new evidence that there are many similarities, and some differences between transcriptional control by E1A in yeast and mammalian cells. Thus, functional analysis of E1A in yeast using genetic approaches has the potential to uncover novel mechanistic aspects of E1A function. Furthermore, genome wide analysis of E1A activity in yeast has the potential to identify novel pathways that also influence E1A function in mammalian cells.

Methods

Yeast strains, media, and plasmid construction

The yeast strains used along with their sources are listed in Additional file 4. Yeast culture media were prepared using standard techniques [57]. The reporter plasmid pSH1834 (8LexA operators-LacZ) was obtained from Invitrogen Corporation. A derivative of this plasmid that can be integrated into the GAL1 locus was constructed by PCR of the reporter cassette, which was subcloned into the pRS306 vector using KpnI and XbaI. The sequences of the oligos used for PCR were GCATCTAGAGGCAGCTG TCTATATGAATTACTCGAGACTAAATCTCATTCAGAAGAAGATCCCCAGCTTGGAAT and GTCGGTACCTTATTATTATTTTTGACACCAGACCAACTGG. This vector was linearized using the unique XhoI site before transforming into yeast. The N-terminus of HAdV-5 E1A (residues 1–82) and CR3 (residues 139–204) [29] were subcloned into the LexA DBD expression plasmid pBAIT [31] using EcoRI and SalI.

Additional file 4. List of all yeast strains and their sources that were used in this study. This table lists all yeast strains and their sources that were used in this study.

Format: XLS Size: 35KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

E1A-mediated transcriptional activation assay: LacZ Activity

Yeast transformations were performed using a modified lithium acetate procedure [58] and plated on synthetic complete (SC) media lacking appropriate nutrients. Wild-type or mutant yeast strains were transformed with the reporter and vector or E1A expression plasmid. β-galactosidase assays were performed as previously described [29]. Briefly, colonies of transformed yeast were picked off plates with sterile wooden sticks and used to inoculate 5 ml of SC liquid media lacking appropriate nutrients. The yeast were grown to a density of A600 = 0.8 to 1.2. 1 ml of cultures was transferred to microcentrifuge tubes, pelleted by brief centrifugation and resuspended in 1 ml of LacZ buffer (60 mM Na2HPO4.7H20, 40 mM NaH2PO4.H20, 10 mM KCl, 1 mM MgSO4) containing 2.7 μl/ml of β-mercaptoethanol. Cells were lysed by addition of 20 μl of chloroform and 40 ul of 0.1% SDS and 1 minute of vortexing. The cell lysates were then incubated at 30°C for 15 minutes. Two hundred μl of 4 μg/ml ONPG (o-Nitrophenyl β-o-Galactopyranoside) was added to each reaction. Reactions were incubated at 30°C until the tube turned light yellow, at which point it was stopped by the addition of 500 μl of 1 M Na2CO3. The tubes were cleared by centrifuging at 21,000 g for 10 minutes. The absorbance at 420 nm was measured for each reaction. Transcriptional activity was measured in LacZ units using the formula: Activity = A420/(A600 × Volume × Time). All assays were done in triplicate. Raw data is presented in Additional file 5. Fold activation of each portion of E1A was determined on a strain by strain basis with respect to the control LexA vector. Changes in activation with respect to parental BY4741 strain yeast were calculated by dividing the mutant strain fold activation by the fold activation from BY4741 obtained within the same experiment. This was done to minimize experimental variability and tests of N-terminus and CR3 dependent activation were performed simultaneously to allow direct comparison.

Additional file 5. Raw data representing average "Miller units" obtained from performing the experiments described in the Methods. This table lists all the raw data obtained in this study.

Format: XLS Size: 48KB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Yeast cell extracts and western blot analysis

Yeast colonies transformed with E1A expression vectors were picked from the SC selection plates and used to inoculate 5 ml of selective SC liquid media. Cultures were grown at 30°C until they reached an OD600 of 1.0. Cells were collected by centrifugation at 4°C (5 minutes at 1500 g). They were washed in 1 ml of ice-cold extraction buffer (10 mM Tris-HCl pH 7.5, 1× complete protease inhibitor cocktail (Roche Diagnostics). The cells were then re-suspended in 200 μl of cold extraction buffer and transferred to a 1.5 ml microtube containing 400 μl of 425–600 micron acid-washed glass beads (Sigma Aldrich). The cells were vortexed at high speed for 30 seconds and then put on ice for 30 seconds for 12 cycles. Four hundred μl of cold extraction buffer was added to the lysate which was vortexed for another 10 seconds. The tubes were then centrifuged at 21,000 g for 10 minutes at 4°C. Two hundred μl of the supernatant was transferred to clean chilled 1.5 ml microtubes. Protein concentrations of the lysates were measured using the DC Assay Kit (Bio-Rad Laboratories). Twenty μg of total protein from each sample was resolved on Novex pre-cast 5–20% gradient Tris-Glycine PAGE gel (Invitrogen). The E1A fusions were detected using rabbit polyclonal anti-LexA antibody (Millipore).

Authors' contributions

All experimental procedures were carried out by AFY. JSM and CJB contributed to the design of the study. All authors read and approved the final manuscript.

Acknowledgements

We thank Drs. Charlie Boone, Joe Martens, Fred Winston, Nikita Avvakumov and Jacques Côté for generous gifts of yeast strains. AFY was supported by an Ontario Graduate Scholarship. This work was supported by Canadian Institutes of Health Research grant MOP-74647.

References

  1. Berk AJ: Recent lessons in gene expression, cell cycle control, and cell biology from adenovirus.

    Oncogene 2005, 24:7673-7685. PubMed Abstract | Publisher Full Text OpenURL

  2. Bayley ST, Mymryk JS: Adenovirus E1A proteins and transformation (Review).

    Int J Oncology 1994, 5:425-444. OpenURL

  3. Pelka P, Ablack JN, Fonseca GJ, Yousef AF, Mymryk JS: Intrinsic structural disorder in adenovirus E1A: a viral molecular hub linking multiple diverse processes.

    J Virol 2008, 82(15):7252-7263. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  4. Kimelman D, Miller JS, Porter D, Roberts BE: E1a regions of the human adenoviruses and of the highly oncogenic simian adenovirus 7 are closely related.

    J Virol 1985, 53:399-409. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  5. Avvakumov N, Wheeler R, D'Halluin JC, Mymryk JS: Comparative sequence analysis of the largest E1A proteins of human and simian adenoviruses.

    J Virol 2002, 76:7968-7975. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  6. Avvakumov N, Kajon AE, Hoeben RC, Mymryk JS: Comprehensive sequence analysis of the E1A proteins of human and simian adenoviruses.

    Virology 2004, 329:477-492. PubMed Abstract | Publisher Full Text OpenURL

  7. Glenn GM, Ricciardi RP: Adenovirus 5 early region 1A host range mutants hr 3, hr4, and hr5 contain point mutations which generate single amino acid substitutions.

    jv 1985, 56:66-74. OpenURL

  8. Lillie JW, Green M, Green MR: An adenovirus E1a protein region required for transformation and transcriptional repression.

    Cell 1986, 46:1043-1051. PubMed Abstract | Publisher Full Text OpenURL

  9. Moran E, Zerler B, Harrison TM, Mathew MB: Identification of separate domains in the adenovirus E1A gene for immortalization activity and the activation of virus early genes.

    MCB 1986, 6:3470-3480. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  10. Moran E, Grodzicker T, Roberts RJ, Mathews MB, Zerler B: Lytic and transforming functions of individual products of the adenovirus E1A gene.

    J Virol 1986, 57:765-775. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  11. Moran E, Mathews MB: Multiple functional domains in the adenovirus E1A gene.

    Cell 1987, 48:177-178. PubMed Abstract | Publisher Full Text OpenURL

  12. Strom AC, Ohlsson P, Akusjarvi G: AR1 is an integral part of the adenovirus type 2 E1A-CR3 transactivation domain.

    J Virol 1998, 72:5978-5983. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  13. Scholer HR, Ciesiolka T, Gruss P: A nexus between Oct-4 and E1A: implications for gene regulation in embryonic stem cells.

    Cell 1991, 66:291-304. PubMed Abstract | Publisher Full Text OpenURL

  14. Agoff SN, Wu B: CBF mediates adenovirus Ela trans-activation by interaction at the C-terminal promoter targeting domain of conserved region 3.

    Oncogene 1994, 9:3707-3711. PubMed Abstract OpenURL

  15. Liu F, Green MR: A specific member of the ATF transcription factor family can mediate transcription activation by the adenovirus E1a protein.

    Cell 1990, 61:1217-1224. PubMed Abstract | Publisher Full Text OpenURL

  16. Liu F, Green MR: Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains.

    Nature 1994, 368:520-525. PubMed Abstract | Publisher Full Text OpenURL

  17. Chatton B, Bocco JL, Gaire M, Hauss C, Reimund B, Goetz J, Kedinger C: Transcriptional activation by the adenovirus larger E1a product is mediated by members of the cellular transcription factor ATF family which can directly associate with E1a.

    MCB 1993, 13:561-570. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  18. Lillie JW, Green MR: Transcription activation by the adenovirus E1a protein.

    Nature 1989, 338:39-44. PubMed Abstract | Publisher Full Text OpenURL

  19. Glenn GM, Ricciardi RP: An adenovirus type 5 E1A protein with a single amino acid substitution blocks wild-type E1A transactivation.

    MCB 1987, 7:1004-1011. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  20. Webster LC, Ricciardi RP: Trans-dominant mutants of E1A provide genetic evidence that the zinc finger of the trans-activating domain binds a transcription factor.

    MCB 1991, 11:4287-4296. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  21. Lee WS, Kao CC, Bryant GO, Liu X, Berk AJ: Adenovirus E1A activation domain binds the basic repeat in the TATA box transcription factor.

    Cell 1991, 67:365-376. PubMed Abstract | Publisher Full Text OpenURL

  22. Boyer TG, Martin ME, Lees E, Ricciardi RP, Berk AJ: Mammalian Srb/Mediator complex is targeted by adenovirus E1A protein [see comments].

    Nature 1999, 399:276-279. PubMed Abstract | Publisher Full Text OpenURL

  23. Wang G, Berk AJ: In vivo association of adenovirus large E1A protein with the human mediator complex in adenovirus-infected and -transformed cells.

    J Virol 2002, 76:9186-9193. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  24. Rasti M, Grand RJ, Yousef AF, Shuen M, Mymryk JS, Gallimore PH, Turnell AS: Roles for APIS and the 20S proteasome in adenovirus E1A-dependent transcription.

    EMBO J 2006, 25:2710-2722. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  25. Pelka P, Ablack JN, Torchia J, Turnell AS, Grand RJ, Mymryk JS: Transcriptional control by adenovirus E1A conserved region 3 via p300/CBP.

    Nuc Acids Res 2009, 37:1095-1106. Publisher Full Text OpenURL

  26. Bondesson M, Mannervik M, Akusjarvi G, Svensson C: An adenovirus E1A transcriptional repressor domain functions as an activator when tethered to a promoter.

    Nuc Acids Res 1994, 22:3053-3060. Publisher Full Text OpenURL

  27. Frisch SM, Mymryk JS: Adenovirus-5 e1a: paradox and paradigm.

    Nat Rev Mol Cell Biol 2002, 3:441-452. PubMed Abstract | Publisher Full Text OpenURL

  28. Horwitz GA, Zhang K, McBrian MA, Grunstein M, Kurdistani SK, Berk AJ: Adenovirus small e1a alters global patterns of histone modification.

    Science 2008, 321:1084-1085. PubMed Abstract | Publisher Full Text OpenURL

  29. Shuen M, Avvakumov N, Walfish PG, Brandl CJ, Mymryk JS: The adenovirus E1A protein targets the SAGA but not the ADA transcriptional regulatory complex through multiple independent domains.

    J Biol Chem 2002, 277:30844-30851. PubMed Abstract | Publisher Full Text OpenURL

  30. Miller ME, Cairns BR, Levinson RS, Yamamoto KR, Engel DA, Smith MM: Adenovirus E1A specifically blocks SWI/SNF-dependent transcriptional activation.

    MCB 1996, 16:5737-5743. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  31. Zhang Z, Smith MM, Mymryk JS: Interaction of the E1A oncoprotein with Yak1p, a novel regulator of yeast pseudohyphal differentiation, and related mammalian kinases.

    Mol Biol Cell 2001, 12:699-710. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  32. Zieler HA, Walberg M, Berg P: Suppression of mutations in two Saccharomyces cerevisiae genes by the adenovirus E1A protein.

    MCB 1995, 15:3227-3237. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. Sang N, Severino A, Russo P, Baldi A, Giordano A, Mileo AM, Paggi MG, De Luca A: RACK1 interacts with E1A and rescues E1A-induced yeast growth inhibition and mammalian cell apoptosis.

    J Biol Chem 2001, 276:27026-27033. PubMed Abstract | Publisher Full Text OpenURL

  34. Mohibullah N, Hahn S: Site-specific cross-linking of TBP in vivo and in vitro reveals a direct functional interaction with the SAGA subunit Spt3.

    GD 2008, 22:2994-3006. Publisher Full Text OpenURL

  35. Bhaumik SR, Green MR: Differential requirement of SAGA components for recruitment of TATA-box-binding protein to promoters in vivo.

    MCB 2002, 22:7365-7371. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  36. Pray-Grant MG, Schieltz D, McMahon SJ, Wood JM, Kennedy EL, Cook RG, Workman JL, Yates JR III, Grant PA: The novel SLIK histone acetyltransferase complex functions in the yeast retrograde response pathway.

    Mol Cell Biol 2002, 22:8774-8786. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  37. Kulesza CA, Van Buskirk HA, Cole MD, Reese JC, Smith MM, Engel DA: Adenovirus E1A requires the yeast SAGA histone acetyltransferase complex and associates with SAGA components Gcn5 and Tra1.

    Oncogene 2002, 21:1411-1422. PubMed Abstract | Publisher Full Text OpenURL

  38. Reid JL, Bannister AJ, Zegerman P, Martinez-Balbas MA, Kouzarides T: E1A directly binds and regulates the P/CAF acetyltransferase.

    EMBO J 1998, 17:4469-4477. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  39. Lang SE, Hearing P: The adenovirus E1A oncoprotein recruits the cellular TRRAP/GCN5 histone acetyltransferase complex.

    Oncogene 2003, 22:2836-2841. PubMed Abstract | Publisher Full Text OpenURL

  40. Ferrari R, Pellegrini M, Horwitz GA, Xie W, Berk AJ, Kurdistani SK: Epigenetic reprogramming by adenovirus e1a.

    Science 2008, 321:1086-1088. PubMed Abstract | Publisher Full Text OpenURL

  41. Biddick R, Young ET: Yeast mediator and its role in transcriptional regulation.

    C R Biol 2005, 328:773-782. PubMed Abstract | Publisher Full Text OpenURL

  42. Boube M, Joulia L, Cribbs DL, Bourbon HM: Evidence for a mediator of RNA polymerase II transcriptional regulation conserved from yeast to man.

    Cell 2002, 110:143-151. PubMed Abstract | Publisher Full Text OpenURL

  43. Wang W: The SWI/SNF family of ATP-dependent chromatin remodelers: similar mechanisms for diverse functions.

    Curr Top Microbiol Immunol 2003, 274:143-169. PubMed Abstract OpenURL

  44. Chandy M, Gutierrez JL, Prochasson P, Workman JL: SWI/SNF displaces SAGA-acetylated nucleosomes.

    Eukaryot Cell 2006, 5:1738-1747. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  45. Fuchs M, Gerber J, Drapkin R, Sif S, Ikura T, Ogryzko V, Lane WS, Nakatani Y, Livingston DM: The p400 complex is an essential E1A transformation target.

    Cell 2001, 106:297-307. PubMed Abstract | Publisher Full Text OpenURL

  46. Flinterman MB, Mymryk JS, Klanrit P, Yousef AF, Lowe SW, Caldas C, Gaken J, Farzaneh F, Tavassoli M: p400 function is required for the adenovirus E1A-mediated suppression of EGFR and tumour cell killing.

    Oncogene 2007, 26:6863-6874. PubMed Abstract | Publisher Full Text OpenURL

  47. Kim J, Hake SB, Roeder RG: The human homolog of yeast BRE1 functions as a transcriptional coactivator through direct activator interactions.

    Mol Cell 2005, 20:759-770. PubMed Abstract | Publisher Full Text OpenURL

  48. Zhu B, Zheng Y, Pham AD, Mandal SS, Erdjument-Bromage H, Tempst P, Reinberg D: Monoubiquitination of human histone H2B: the factors involved and their roles in HOX gene regulation.

    Mol Cell 2005, 20:601-611. PubMed Abstract | Publisher Full Text OpenURL

  49. Wood A, Schneider J, Dover J, Johnston M, Shilatifard A: The Bur1/Bur2 complex is required for histone H2B monoubiquitination by Rad6/Bre1 and histone methylation by COMPASS.

    Mol Cell 2005, 20:589-599. PubMed Abstract | Publisher Full Text OpenURL

  50. Henry KW, Wyce A, Lo WS, Duggan LJ, Emre NC, Kao CF, Pillus L, Shilatifard A, Osley MA, Berger SL: Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8.

    GD 2003, 17:2648-2663. Publisher Full Text OpenURL

  51. Shahbazian MD, Zhang K, Grunstein M: Histone H2B ubiquitylation controls processive methylation but not monomethylation by Dot1 and Set1.

    Mol Cell 2005, 19:271-277. PubMed Abstract | Publisher Full Text OpenURL

  52. Schneider J, Wood A, Lee JS, Schuster R, Dueker J, Maguire C, Swanson SK, Florens L, Washburn MP, Shilatifard A: Molecular regulation of histone H3 trimethylation by COMPASS and the regulation of gene expression.

    Mol Cell 2005, 19:849-856. PubMed Abstract | Publisher Full Text OpenURL

  53. Santos-Rosa H, Schneider R, Bernstein BE, Karabetsou N, Morillon A, Weise C, Schreiber SL, Mellor J, Kouzarides T: Methylation of histone H3 K4 mediates association of the Isw1p ATPase with chromatin.

    Mol Cell 2003, 12:1325-1332. PubMed Abstract | Publisher Full Text OpenURL

  54. Vary JC Jr, Gangaraju VK, Qin J, Landel CC, Kooperberg C, Bartholomew B, Tsukiyama T: Yeast Isw1p forms two separable complexes in vivo.

    MCB 2003, 23:80-91. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  55. Hartzog GA, Wada T, Handa H, Winston F: Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae.

    GD 1998, 12:357-369. Publisher Full Text OpenURL

  56. Wada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S, Sugimoto S, Yano K, Hartzog GA, Winston F, et al.: DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs.

    GD 1998, 12:343-356. Publisher Full Text OpenURL

  57. Adams A, Gottschling DE, Kaiser CA, Stearns T: Methods in yeast genetics, 1997 Edition edn. Plainview N.Y.: Cold Spring Harbor Laboratory Press; 1998. OpenURL

  58. Gietz RD, Schiestl RH, Willems AR, Woods RA: Studies on the transformation of intact yeast cells by the LiAc/SS- DNA/PEG procedure.

    Yeast 1995, 11:355-360. PubMed Abstract | Publisher Full Text OpenURL