Table 1

Sequences chosen to generate shRNA constructs that were successfully transfected into amebae

Name

Sequence

Location in mRNA/cDNA (bp from ATG)

Total length of target mRNA (bp)


Igl1 (272–300)

AAGTAAATACATCATCACACTCTGGAAAT

272–300 (Igl1)

3306 (Igl1), 3318 (Igl2)

Igl (1198–1226)

AATGGACTTACATTGAATGGAACTCATTG

1198–1226 (Igl1)

Igl (2412–2440)

AACAGAATGTTCAGATGGTTTTAGTGGAC

2412–2440 (Igl1)

Igl (2777–2805)

AAGGAACATGTATACCATGCACATCACCA

2777–2805 (Igl1)

URE3-BP (350–378)

AACTTGCATACAATCTCTTCGTTATGAAC

350–378

663

URE3-BP (580–608)

AATCCATACTATGGTCCAATGAAACCATT

580–608

EhC2A (363–391)

AATGGTTCCACCAATGCAACCAGGCATGA

363–391

567

EhC2A (502–530)

GCTTACCCACCACCTGGATATCCACCAA

502–530; also 406–434

EhC2A (363–391 scrambled)

AAGGCTAGACAATCCAGACCGTTCCAGAT

Does not match any E. histolytica mRNA

None


GFP

AAGGTGATGCAACATACGGAAAAC

Does not match any E. histolytica mRNA

None


The Ambion siRNA finder [51] was used to select 21 mers from the entire coding sequence of URE3-BP, the poly-proline region of EhC2A, or the identical or divergent regions of Igl1 and Igl2, which were then checked for sufficient GC content, lengthened to 29 nucleotides, and tested for sufficient sequence uniqueness by blasting each 29 mer using the E. histolytica Genome Project database [52]. A scrambled sequence was created as a control for EhC2A. A sequence directed against GFP [30] was included as a control for the Igl and URE3-BP selections. The constructs are named such that the numbers in parentheses following the gene name indicated the location of the shRNA sense strand within that gene sequence.

Linford et al. BMC Microbiology 2009 9:38   doi:10.1186/1471-2180-9-38

Open Data