Table 1

PCR primers used for gene amplification and sequencing.

Gene(s)

Primer name

Sequence (5'-3')

Size (bp)

Tm (°C)

Reference


gyrB

gyr-320

TAARTTYGAYGAYAACTCYTAYAAAGT

970

50

[63]

rgyr-1260

CMCCYTCCACCARGTAMAGTTC

[63]

hrcN

hrcN-4r

CGAGCAGGAYTCGATGAACG

250

50

[57]

hrcN-5rR

CCGGWYTGGTATTCACCCAG

[57]

29-kbp GI

mutS-rev

CGCCATCGGGATCGGTTCGCC

554

60

This work

narL-rev

GCCGTCTGGGCGCTGCAGAACG

This work

paaABC

paaA-fw

CTCTTGCCAAAATGGATGGT

2398

55

This work

paaC-rev

TTGCAAATTCTGCACTCTCG

This work

pagRI

pagR-fw

GTGAAGGATACYTACTACAACG

1206-29

55

This work

pagI-rev

CGAATGCATTGACGGCATGG

This work

rrs

16S-8F

AGAGTTTGATCCTGGCTCAG

1503

48

[64]

16S-533R

TTACCGCGGCTGCTGGCAC

[64]

16S-609R

ACTACYVGGGTATCTAAKCC

[65]

16S-1492R

ACGGTTACCTTGTTACGACTT

[64]


Tm = annealing temperature

Rezzonico et al. BMC Microbiology 2009 9:204   doi:10.1186/1471-2180-9-204

Open Data