Table 3

Primers used in this work

Primer

Sequence (5'-3')

Restriction enzymea,b


KO1XLc

GC

    TCTAGA
CTCGATGCCGCGCTGCTGGA

XbaI

KO1BLc

TT

    GGATCC
GCGGTTCCGACTATCGCAAG

BamHI

KO1BRc

TT

    GGATCC
CAGGCACGCTACCGCAG

BamHI

KO1KRc

GG

    GGTACC
ATCTGCGTCTCTTCCTTG

KpnI

OP13LXd

GC

    TCTAGA
GGCGGCACACCGTCGAAC

XbaI

OP13LBd

TTCG

    GGATCC
CATCTGGCCGCCGTTTAT

BamHI

OP13RBd

TTCG

    GGATCC
TAATCGGCGATGTGTTGC

BamHI

OP13REd

TG

    GAATTC
GCCACCCCCGCTCTCCCTTG

EcoRI

KO4XLe

GC

    TCTAGA
CCGTGATCCTGAACATCGTG

XbaI

KO4NLe

TT

    CATATG
CGCAGACGGATCTGTACG

NdeI

KO4NRe

TT

    CATATG
CTGCGCGACGAGGAATGC

NdeI

KO4KRe

GG

    GGTACC
CTGCTGGTAACAATCTGTAA

KpnI

KO1F

GAGGTCCAGCACGATGATG

N/A

KO1R

CGAGCATGTCCGTGACCAGT

N/A

CO13OPL

TCAAAGGGGTGTGGGCGGG

N/A

CO13OPR

GATTAAGGGAATTTCTTCTTGC

N/A

KO4F

GTCGCCGCACTTCTTCTC

N/A

KO4R

TCCTTGGTACGTCTGACC

N/A


a Restriction endonuclease sites incorporated in the oligonucleotide sequences are underlined.

b N/A indicates the absence of restriction site.

c The PCR cycling conditions used with these primers were: 95°C for 5 min followed by 30 cycles of 94°C for 15 s, 62°C or 52°C for 1 min respectively, and 72°C for 1 min, with a final extension at 72°C for 10 min.

d The PCR cycling conditions used with these primers were: 95°C for 15 min followed by 25 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 10 min.

e The PCR cycling conditions used with these primers were: 95°C for 5 min followed by 30 cycles of 94°C for 15 s, 54°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 10 min.

Buroni et al. BMC Microbiology 2009 9:200   doi:10.1186/1471-2180-9-200

Open Data