Table 3

DDT sequencing of regions showing different whole genome fingerprint profiles in SS14 strain
Region no.	ORF^a	Difference from WGF on the gel	Size of sequenced region (nt)^b	Left coordinate^a	Right coordinate^a	Newly found changes	Confirmation of SNPs identified by CGS^c

1	TP0124–TP0134	insertion	3245 + 1255 insertion	145858	149102	1255 nt insertion, 2 nt deletion	-
			1362	149563	150924	-	-
			252	151648	151899	-	-
			3465	152043	155507	1 nt insertion	2 SNPs

2	TP0135–TP0138	deletion	662	155686	156347	-	(+ 64 nt deletion as in Table 1)
			894	158391	159284	1 nt deletion

3	TP0433–TP0434	insertion	481 + 419 insertion	461058	461538	insertion of 7 repeats of 60 nt region altogether 14 repetitions, consensus sequence of the repeat CGTGAGGTGGAGGACGYGCCGRRGGTAGTG GAGCCGGCCTCTGRGCRTGARGGAGGGGAG	-

4	TP0468–TP0471	deletion	3571	495308	498878	2 nt deletion + 1 nt insertion + deletion of seven 24 nt repetitions, consensus sequence of the repeat CTCCGCCTCCTTGCGCCGGGCTTC	1 SNP

nt – nucleotide; SNP – single nucleotide polymorphism; ^aas described in [3]; ^bregions previously described in Table 1 were excluded; ^cSNPs identified using CGS in these regions were verified by DDT sequencing.
Matějková et al. BMC Microbiology 2008 8:76 doi:10.1186/1471-2180-8-76