Table 2

Primer combinations used to validate each fimbrial mutation.

Primer combination

Predicted amplicon size (bp)

Sequence (5'-3')


bcfAFOR + C1

633

TGCACTATCCGCAACGATATATTT


bcfAREV + C2

507

TAAAATACGCTTTCGCGATCGGTCGGT


csgAFOR + C2

173

CAAGGAGCAATAAAGTATGCATAATTT


csgAREV + C1

302

CAGCAGTTGTAGTGCAGAAACAGTCGCATA


lpfAFOR + C2

867

TTAGTTACGCGCTGTGTCAA


lpfAREV + C1

288

ATCCAATACCCACCTCTATACACTCCA


fimAFOR +C1

807

AACCTCAGATCGCACCTGCTGC


fimAREV + C2

429

ATGCCGACATGACGCCAGACC


sefAFOR + C1

373

CTATTAATGGGGATGTTGTGTAA


sefAREV + C2

946

CTAATAATCTCTTATAATTTC


safAFOR + C1

701

TGAGACTCTCTCATTGGAGCGCT


safAREV + C2

597

AATTGAGGTCAAGGGTCGCGCC


stbAFOR + C2

887

TTAATGGTGGGGGACATCGTA


stbAREV + C1

295

TTATTTTTACCACTCCATAAGCACGAA


pegAFOR + C2

179

CACAAGCCAGGCATAATGCAATCATC


pegAREV + C1

377

ACATTGCGATAACTTCCTGTCTATGAGAA


stdAFOR + C2

587

GCTGTACCGTACCTGACTGTC


stdAREV + C1

714

TGTTTTTAAATTTCATCCGCGAAG


steAFOR + C1

739

TACGACAACGCCTATATAATA


steAREV + C2

600

AGCAGCGTGGAGTGTCCCAGGTCAGC


stfAFOR + C1

283

CATATAAACATGGGGTATTGATGA


stfAREV + C2

155

GGCTGGCATCATCTTTAACA


sthAFOR + C1

584

GCGTTGATTTTGTTAATGC


sthAREV + C2

704

GAAAGCTCACGATTTGAGATCAAC


stiAFOR + C2

385

TTTGGCCGACAACACACTATG


stiAREV + C1

661

GTAAATCAGCTTAAATTCCG


C1

-

TTATACGCAAGGCGACAAGG


C2

-

GATCTTCCGTCACAGGTAGG


Primers are specific to the flanking regions of the specified fimbrial gene (FOR or REV) or the chloramphenicol resistance cassette (C1 – forward or C2 – reverse).

Clayton et al. BMC Microbiology 2008 8:228   doi:10.1186/1471-2180-8-228

Open Data