Table 1

Primers used to construct major fimbrial subunit mutations in S. Enteritidis P125109

Name

Sequence (5'-3')


stbAFmut

ATGTCTATGAAAAAATATTTAGCAATGATCACAGGCTCGCTGTGTAGGCTGGAGCTGCTTCG


stbARmut

TTATTTATACGAAACGGCGTATTGTAGGGTGGCAGCGACTCATATGAATATCCTCCTTA


pegAFmut

ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTGTGTAGGCTGGAGCTGCTTCG


pegARmut

TTAATCAGTTAATACCGTCATCGTCAGTACAGATTCAACACATATGAATATCCTCCTTA


stdAFmut

GTGCTTCGTTTAACACCAGGCGTTTATTATTCATACGAATTGTGTAGGCTGGAGCTGCTTCG


stdARmut

TCACAGGTATTTCAGGGTGTAGGTGACGGATGCGTTGAAGCATATGAATATCCTCCTTA


steAFmut

ATGAAGTCATCTCATTTTTGTAAACTGGCAGTAACTGCATGTGTAGGCTGGAGCTGCTTCG


steARmut

TTACAGGTAAGAGATAGTGACGTTGGCGGCGCTGCTGAACATATGAATATCCTCCTTA


stfAFmut

ATGAATACAGCAGTAAAAGCTGCGGTTGCTGCCGCACTGGTGTGTAGGCTGGAGCTGCTTCG


stfARmut

TTACAGATAGCTGATCGTGAAGTTTACGGTGCTGCTGAATCATATGAATATCCTCCTTA


sthAFmut

ATGTTTAATAAGAAAATTATCATCCTGGCAATGTTAACTTGTGTAGGCTGGAGCTGCTTCG


sthARmut

TTACTGATACGAAACGGTATACGTAACCTGAGTGCTAACACATATGAATATCCTCCTTA


stiAFmut

ATGAAACTCTCCTTAAAAACACTCACTGTGGCACTGCCGTGTGTAGGCTGGAGCTGCTTCG


stiARmut

TCAGTTATATTGCAGATAGAATGTTGCGGTTGCATCGACCCATATGAATATCCTCCTTA


bcfAFmut

ATGAAAAAGCCTGTACTAGCATTAATGGTCTCTGCCATTGTGTGTAGGCTGGAGCTGCTTC


bcfARmut

TCAGGAATAAACCATGCTAAATGTCGCCGTCGCGGTAACCATATGAATATCCTCCTTA


csgAFmut

ATGAAACTTTTAAAAGTGGCAGCATTCGCAGCAATCGTAGTTGTGTAGGCTGGAGCTGCTTCG


csgARmut

TTAATACTGGTTAGCCGTGGCGTTGTTGCCAAAACCAACCCATATGAATATCCTCCTTA


lpfAFmut

ATGGAGTTTTTAATGAAAAAGGTTGTTTTTGCTCTGTCTGTGTGTAGGCTGGAGCTGCTTCG


lpfARmut

TTATTCGTAGGACAGGTTGAAGTCACTTCTGCGTTACCGCATATGAATATCCTCCTTA


fimAFmut

ACCTCTACTATTGCGAGTCTGATGTTTGTCGCTGGCGCATGTGTAGGCTGGAGCTGCTTCG


fimARmut

TTATTCGTATTTCATGATAAAGGTGGCGTCGGCATTAGCCTGCATATGAATATCCTCCTTA


sefAFmut

ATGCGTAAATCAGCATCTGCAGTAGCAGTTCTTGCTTTAATGTGTAGGCTGGAGCTGCTTCG


sefARmut

GTTTTGATACTGCTGAACGTAGAAGGTCGCAGTGGGTCCATTTCATATGAATATCCTCCTTA


safAFmut

GTGGTTATTCAAATGAAAAGCATAAAAAAATTGATTATCGTGTGTAGGCTGGAGCTGCTTCG


safARmut

TTAAGGCTGATATCCCACTACGTCTACAGTTATTGGGTACCATATGAATATCCTCCTTA


The primers were designed to mutate the major fimbrial subunit by lambda Red recombinase-mediated integration of linear PCR products. Forward and reverse primers were used to amplify the pKD3-derived chloramphenicol cassette and contain 40 bp homology extensions 5' and 3' of the target gene.

Clayton et al. BMC Microbiology 2008 8:228   doi:10.1186/1471-2180-8-228

Open Data