Table 2

16S ribosomal gene primers used for PCR amplification or DGGE

Primer

Sequence (5'-3')

Primer target sitea

Reference


Amp F

GAGAGTTTGATYCTGGCTCAG

0006

[13]


Amp R

AAGGAGGTGATCCARCCGCA

1530

[13]


InfL6b

TATCGGGGAGCAAGCGAG

0445

[53]


Bif662-r

CCACCGTTACACCGGGAA

0662

[3]


ENT183c

CGTCGCAAGACCAAAGAG

0183

[54]


424R

CCGCTGAAAGTACTTTACAACC

0424

This study


F-968d

GAACGCGAAGAACCTTAC

0968

[55]


R-1401

CGGTGTGTAGAAGACCC

1401

[55]


F-341d

CCTACGGGAGGCAGCAG

0341

[56]


R-534

ATTACCGCGGCTGCTGG

0534

[56]


a Primer target site according to E. coli 16S ribosomal gene numbering as the reference.

b This primer was known as B. longum grp3 for the microarray.

c This primer was designated Enterobacteriaceae1 for the microarray.

d A 39 nt GC clamp was added to the 5' end of the primer when used for DGGE.

Harrington et al. BMC Microbiology 2008 8:195   doi:10.1186/1471-2180-8-195

Open Data