Table 1

Primers used for multiplex PCR to detect and differentiate Salmonella enterica serogroups and serovars

Target gene1

Nucleotide sequence

Expected Size (bp)


O-antigen multiplex

abe1 (B)

F: GGCTTCCGGCTTTATTGG

561

R: TCTCTTATCTGTTCGCCTGTTG

wbaD-manC (C1)

F: ATTTGCCCAGTTCGGTTTG

341

R: CCATAACCGACTTCCATTTCC

abe2 (C2)

F: CGTCCTATAACCGAGCCAAC

397

R: CTGCTTTATCCCTCTCACCG

prt (A/D1)

F: ATGGGAGCGTTTGGGTTC

624

R: CGCCTCTCCACTACCAACTTC

wzx wzy (E1)

F: GATAGCAACGTTCGGAAATTC

281

R: CCCAATAGCAATAAACCAAGC


H1-1 multiplex

fliC (i)

F: AACGAAATCAACAACAACCTGC

508

R: TAGCCATCTTTACCAGTTCCC

fliC (g,m)

F: GCAGCAGCACCGGATAAAG

309

R: CATTAACATCCGTCGCGCTAG


H1-2 multiplex

fliC (r)

F: CCTGCTATTACTGGTGATC

169

R: GTTGAAGGGAAGCCAGCAG

fliC (z10)

F: GCACTGGCGTTACTCAATCTC

363

R: GCATCAGCAATACCACTCGC


H2 multiplex

fljB (I: 1,2; 1,5; 1,6; 1,7)

F: AGAAAGCGTATGATGTGAAA

294

R: ATTGTGGTTTTAGTTGCGCC

fljB (II: e,n,x; e,n,z15)

F: TAACTGGCGATACATTGACTG

152

R: TAGCACCGAATGATACAGCC


1Indicates the unique genes or the junctions between the two genes used for designing PCR primers. () = antigen(s) detected.

Hong et al. BMC Microbiology 2008 8:178   doi:10.1186/1471-2180-8-178

Open Data