Table 3

Oligonucleotide primers and TaqMan probes used in RT-qPCR analysis of gene expression

Gene

Sequences (5'→3')

Source


Primer

Taqman Probe (Fam-Tamra)

CpsA

F: CTTTGCAGTACAGCAGTTTGTTG

ACTGACCAATCGTTTAAATG

Ref. [25]

R: TCTGCTAAAACAGCGACACTGA

gyrB*

F: CCAAACCGACTATTCAGCGTTAT

TGAAATGGACGATCATCAGCTGTGGGA

In this study

R: TGTTCGGGATCCATGGTTGT


*gyrB was used as endogenous control.

Hall-Stoodley et al. BMC Microbiology 2008 8:173   doi:10.1186/1471-2180-8-173

Open Data