Table 1

Bacterial strains, plasmids and primers used in this study.

Bacterial strains

Relevant properties

Source/Reference


Escherichia coli TOP10

F-mcrA φ80lacZ_M15 lacX74recA1araD galU rpsL endA1 nupG

Invitrogen, UK.

Bifidobacterium breve UCC2003

Electroporation host

UCC Culture Collection.


Plasmids

Relevant properties

Source/Reference


pPl2lux

Allows for translational fusions to luxABCDE operon

[2]

pUC19

2.686 kb vector based on pMB1, Ampr

Fermentas

pUC19-lux

pUC19 containing the 5.6 kb modified luxABCDE operon as SalI – PstI fragment.

[2]

pBC1.2

Bifidobacterial shuttle vector based on pBC1, Cmr

[14]

pLuxMC1

pBC1.2 containing the modified luxABCDE operon

This study

pLuxMC2

pBC1.2 containing the luxABCDE operon plus promoter of repC from pBC1

This study

pLuxMC3

pBC1.2 plus luxABCDE operon with Phelp [3].

This study


Primers

Sequence

Source/Reference


IM111

Aaaaggacgatttcggttgg

[2]

IM112

Ccaatgccccagaaatttcc

[2]

Prep F

Ccatccaa

    ctcgag
gcacaagccgcgcgagcggtc

This study

Prep R

Catgggcactagtgtacgtc

This study


Ampr, ampicillin resistance; Cmr chloramphenicol resistance. Underlining indicates restriction sites used in subsequent cloning steps

Cronin et al. BMC Microbiology 2008 8:161   doi:10.1186/1471-2180-8-161

Open Data