Table 3

Primer sequences

Primer Name

Nucleotide Sequence 5'-3'

Target

PCR Conditionsa


PCR Primers

Denature

Anneal

Extension


BGR1U

TCAACGAAAAATAACTTCGCTGAATCCC

Stx1 Base 1–28

95°C,

61°C,

72°C,

BGR1D

CAGTTAATGTGGTTGCGAAGGAATTTACC

Stx1 Base (1150–1178)

60 sec

60 sec

240 sec

BGR2U

ATGAAGTGTATATTATTTAAATGGGTACTGTG

Stx2 Base 1–32

95°C,

61°C,

72°C,

BGR2D

TCAGTCATTATTAAACTGCACTTCAG

Stx2 Base (1201–1226)

60 sec

60 sec

240 sec

Sequencing Primers

Target


Stx1SeqF

TGTAACCGCTGTTGTACCTGG

Stx1 Base (367–387)

Stx1SeqR

TTAATACTGAATTGTCATCATCATGC

Stx1 Base 778–803

Stx2SeqF

TTGCATTAGCTTCTGTTAATGCA

Stx2 Base 1000–1022

Stx2SeqR

CATTCCGGAACGTTCCAG

Stx2 Base (433–450)


a PCR was performed for 30 cycles followed by a final extension step of 10 min at 72°C.

Lee et al. BMC Microbiology 2007 7:109   doi:10.1186/1471-2180-7-109

Open Data