Table 1

Primers Used in PCR screening of Phage Genes and Phage Excision Products

Primer

PCR product

Location


Primer Name

ORF/gene product

Sequence 5' to 3'

Length

Size (bp)


ORF01192Fa

BA0479-hypothetical

AAACCCTGGGACCTCTGAAC

20

1002

prophage 04

ORF01192Ra

BA0479-hypothetical

GGAAGAATCGCACGACCATC

20

prophage 04

ORF02190Fa

BA5356-Terminase, large subunit

GACATCGTTGCACCTTCACAAG

22

1462

prophage 03

ORF02190Ra

BA5356-Terminase, large subunit

CCAAATGTCGAGCATCTTGTTC

22

prophage 03

ORF03655 Fb

BA4094-Terminase, large subunit

TTGATCGATCCATCTCCTGAAC

22

1192

prophage 02

ORF03655 Rb

BA4094-Terminase, large subunit

GATCAACTTTAGCCTGCGGAAC

22

prophage 02

Ba02 #7 Forc

BA4094-Terminase, large subunit

CAAAGACAGATCCACCTGGAC

21

304

prophage 02

Ba02#7 Revc

BA4094-Terminase, large subunit

CAAAGGGAGGTTCAGCATCTC

21

prophage 02

ORF03991 Fa

BA3805-Acyl transferase

AGTTGCATGCCCAGTTCTTG

20

1205

prophage 01

ORF03991 Ra

BA3805-Acyl transferase

CTGCGTGACTGGAATCCCTTAC

22

prophage 01

Ba04INF

LambdaBa04 left junction

CCAGTTGAATCCAGAACAAACG

22

871

prophage 04

Ba04OUTR

LambdaBa04 left junction

GGGCAGTCATACGAGGATAATG

22

(961,865)d

prophage 04

Ba04OUTF

LambdaBa04 right junction

CCTTCGCTTTGAATTCCTTCTC

22

997

prophage 04

Ba04INR

LambdaBa04 left junction

GAATTGTAACGAGCATGGAAGC

22

prophage 04

Ba03INF

LambdaBa03 left junction

ACGTTACCCCTATTTCCGAAGC

22

938

prophage 03

Ba03OUTR

LambdaBa03 left junction

CATTTTAATGCGCCCACGAC

20

(923, 952)d

prophage 03

Ba03OUTF

LambdaBa03 right junction

TTCCACATCTTCCTTCAGCAAC

22

977

prophage 03

Ba03INR

LambdaBa03 left junction

GGCCGTACTGGCTTAACTTCTG

22

prophage 03

Ba02INF

LambdaBa02 left junction

TCACTTGCCAGTCTTGACCTTG

22

891

prophage 02

Ba02OUTR

LambdaBa02 left junction

GGTGCATAAGGCGGTAAAGATG

22

(861,962)d

prophage 02

Ba02OUTF

LambdaBa02 right junction

GGCGAGGTATTAGCTTTACAGTGG

24

976

prophage 02

Ba02INR

LambdaBa02 left junction

GTCCATCTTCACTGCCGAAAC

21

prophage 02

Ba011NF

LambdaBa01 left junction

ACAAATTCAGTTGCGCTTCC

20

1053

prophage 01

Ba010UTR

LambdaBa01 left junction

TGCAGCACCTACACTGAAACAAG

23

(878, 1047)d

prophage 01

Ba010UTF

LambdaBa01 right junction

CGATGGAAAGTTCTTACCGAAG

22

915

prophage 01

Ba011NR

LambdaBa01 left junction

ATGATGCTCGTCACTTCATCG

21

prophage 01

gmk F

BC guanylate kinase, putative

ATTTAAGTGAGGAAGGGTAGG

21

500

chr

gmk R

BC guanylate kinase, putative

GCAATGTTCACCAACCACAA

20

chr

PA1 For

Protective antigen

ATCACCAGAGGCAAGACACC

20

311

pXO1

PA1 Rev

Protective antigen

CCATTGTTTCAGCCCAAGTT

20

pXO1

bla F

Amp resistance

TTACCAATGCTTAATCAGTGAGGC

24

861

plasmid

bla R

Amp resistance

ATGAGTATTCAACATTTCCGTGTC

24

plasmid

Primers Used in Real Time PCR for determination of Phage Excision Frequencies

Bce_glpR

BC glycerol kinase

GCAGTAGCGGTTGCAGCATA

20

150

chr

Bce_glpF

BC glycerol kinase

CCCGATAATTGCCCCAATC

19

chr

Ba04circF

LambdaBa04 circle junction

TCAAACCCATCAACAATTTCATTG

24

129

Extra-chr

Ba04circR

LambdaBa04circle junction

CAATAGAATGCACAACAGTGACATAAGT

28

Extra-chr

Ba03circF

LambdaBa03 circle junction

CAAGGGTTGTAGCTGATAGCTCATT

25

170

Extra-chr

Ba03circR

LambdaBa03 circle junction

TGACAAAGTTCAGTCGATTTTTTTCT

26

Extra-chr

Ba02circR

LambdaBa02 circle junction

GACCACAACTTGTACCACATTTATTATTT

29

166

Extra-chr

Ba02circF

LambdaBa02 circle junction

CCGCAATATAGGTGGTATAATGCA

24

Extra-chr

Ba01circF

LambdaBa01 circle junction

CCCACAAAATAAAAAAACCCTCAA

24

150

Extra-chr

Ba01circR

LambdaBa01 circle junction

ACGTTTTTGGCGCAATTTAAA

21

Extra-chr

Ba04mtF

LambdaBa04 deleted junction

AGCACGTGATGTACAAGCGTTAA

23

150

φ free chr

Ba04mtR

LambdaBa04 deleted junction

TATTCCCTCATATCATGAGGGAATATG

27

φ free chr

Ba03mtF

LambdaBa03 deleted junction

TGGCCAAATCAAAACTGGTTCT

22

165

φ free chr

Ba03mtR

LambdaBa03 deleted junction

TTCTCACGGTCTGTCGTTATTTTC

24

φ free chr

Ba02mtF

LambdaBa02 deleted junction

ATATCACCTCAAGGCAACAAACAA

24

150

φ free chr

Ba02mtR

LambdaBa02 deleted junction

GGTAATCTCTCCTTTCGATGTAGCA

25

φ free chr

Ba01mtF

LambdaBa01 deleted junction

CATTAGGAGATCACTTACTTGAGCACTT

28

161

φ free chr

Ba01mtR

LambdaBa01 deleted junction

CACAAATAAAAAAACCTTGATACCGTAGT

29

φ free chr

Primers Used in Real time PCR screening of Prophage Genes

Primer

PCR product

Location

Ba04-RT-F

BA0479-hypothetical

TATAATGGGCACTCCATTTTGGT

23

150

prophage 04

Ba04-RT-R

BA0479-hypothetical

TCCACAGTGGCATTTACCTTTG

22

prophage 04

Ba03-RT-F

BA5356-Terminase, large subunit

TCCTATCGAGAATGGGTTCAACTAT

25

150

prophage 03

Ba03-RT-R

BA5356-Terminase, large subunit

GCGTCCCTACCGTTCAACTG

20

prophage 03

Ba02-RT-F

BA4094-Terminase, large subunit

TGCGTTTTATCATGGAAAATGC

22

150

prophage 02

Ba02-RT-R

BA4094-Terminase, large subunit

TGAGCCAGGTGCTCGTGTT

19

prophage 02

Ba01-RT-F

BA3805-Acyl transferase

CACTTGAATCAACTGGTATCGTGAA

25

150

prophage 01

Ba01-RT-R

BA3805-Acyl transferase

AAATCCAAATTGAGGCATATGATGA

25

prophage 01


asimplex and multiplex; bsimplex only; cmultiplex only; dsizes of PCR products of phage circle and phage excised chromosomal junction respectively

Sozhamannan et al. BMC Microbiology 2006 6:34   doi:10.1186/1471-2180-6-34

Open Data