Table 2

Primers used for cDNA synthesis, qPCR and Two-Hybrid cloning
Primer name Sequence 5′-3′ Purpose
T12VN TTTTTTTTTTTTVN cDNA synthesis
tpsAF TGAGGGCTGTTGTGAATGAGC qPCR tpsA
tpsAR ACTCGGAAAGCACCAAGACACC
tpsBF GTGGGCAGAATCAACGGAAAG qPCR tpsB
tpsBR TGAACACTTGGATAGTTCGGCAAC
tpsCF TTGCCGATGCCTGCTTGTTG qPCR tpsC
tpsCR TTCGCTGGATGGAAAGTAAGACAC
tppAF TTGAAGACACCGTTGGGAAGAG qPCR tppA
tppAR GGAGCAAAAGATGAACTCAGGAGC
tppBF TGGACACTTACCTCTGGGATGAAG qPCR tppB
tppBR GCTGATGGGCATTGAGTATTTCC
tppCF AAAGCCAAAGCAGCCGAATC qPCR tppC
tppCR TGCCCGTTAGTATCCTCAGCAGAG
actF TCGTGACCTGACGGATTACCTC qPCR actin
actR TGGAAGAAGGAGCAAGAGCAGTG
pKT25F ACGATTTCGAGGCGGTCAAG Confirmation of cloned cDNA to pKT25 vector
pKT25R GATGTGCTGCAAGGCGATTAAG
pUT18CF TGTCTTCTACGAGAACCGTGCATAC Confirmation of cloned cDNA to pUT18C vector
pUT18CR CGGTGAAAACCTCTGACACATGC
tpsAFpst GACTCTGCAGCCGTTTCCGACAGCATGCCTT Cloning of tpsA cDNA
tpsAFbam TATCTGGATCCCGTTTCCGACAGCATGCCTT
tpsARkpn TGATCGGTACCAGCTCACTGTGCCACCTGCT
tpsBFbam ATCAGGATCCTCCTTTTCCAATGGCTGCCAA Cloning of tpsB cDNA
tpsBeco ATCAGAATTCAGCTGCAGTCATAACATAATCA
tpsCFxba AGTCTCTAGAATCCAGAATGACGAAGCGCAA Cloning of tpsC cDNA
tpsCReco ACTCGAATTCCGTCCATGTCAGGGCTCAA
tppAxbaF ACTGTCTAGAATCCCCCATCATGCT Cloning of tppA cDNA
tppAecoR AGTAGAATTCATTAACAGAACCCTCAATAC
tppBxbaF TACATCTAGATGTCGCCATGACCATCTACA Cloning of tppB cDNA
tppBkpnR TTCCGGTACCCCTTTCACTCCTTATCGTGA
tppCFsal TATCGTCGACCACCCCAATGACGGTCTTCAT Cloning of tppC cDNA
tppCRbam CATAGGATCCTCAGTCATGGCTTTCTCCGT

Svanström et al.

Svanström et al. BMC Microbiology 2014 14:90   doi:10.1186/1471-2180-14-90

Open Data