Table 1

Sequences of the primers used for amplification and sequencing
Primer name Sequences (5′-3′) Estimated product length
LacDP26F GAGCCAAGAGAGACCCACAG
LacDP347R TTATGTCCGAATGTCGTTGA 321
LacDP326F GTTCAACGACATTCGGACAT
LacDP712R AACGTAGTGACCCTGAAGCC 386
LacDP693F GGCTTCAGGGTCACTACGTT
LacDP903R GTATCCTGTCGGGGTAACCG 210
LacDP886F GTTACCCCGACAGGATACGC
LacDP1208R GAAAGACTCGGTTGGTGTCG 322
LacDP1188F GCGACACCAACCGAGTCTTT
LacDP1400R TACAATATCGCCTGCCCTCT 212
LacDP1380F GAGAGGGCAGGCGATATTGT
LacDP1695R GGGAGCGAGTCAACAACCTA 315
LacDP1661F AATCTCCGCCATGCTTAGG
LacDP1990R GGCTGGTCTCCCGTACAAT 329

Popiel et al.

Popiel et al. BMC Microbiology 2014 14:82   doi:10.1186/1471-2180-14-82

Open Data